Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087477 Similarity: 0.883 Similarity: 0.880 Similarity: 0.880
UTR: 5HSAA087477
Gene: RAB35_0
MFE: -75.625
ENS: 0.686
Length: 300.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000233587B_1703345
MFE: -95.180
Ligand: cobalamin
Species: Niastella vici Cobalamin riboswitch
 RS: URS0002330151_1121476
MFE: -82.873
Ligand: cobalamin
Species: Dethiosulfatibacter aminovorans DSM 17477 Cobalamin riboswitch
 RS: URS000231DF09_218491
MFE: -84.920
Ligand: cobalamin
Species: Pectobacterium atrosepticum SCRI1043 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087477 URS000233587B_1703345 URS0002330151_1121476 URS000231DF09_218491
Length 300. 299. 301. 301.
Similarity - 0.883 0.880 0.880
Ensemble Norm 0.686 - - -
MFE -75.625 -95.180 -82.873 -84.920
Ligands - cobalamin cobalamin cobalamin
Gene RAB35 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 51.002 40.001 25.
Length SE - 1. 1. 1.
Lev Distance - 128. 138. 147.
UBS 19. 21. 22. 20.
BS 0. 0. 0. 0.
ILL 4. 5. 6. 7.
ILR 9. 4. 6. 8.
H 3. 7. 7. 5.
BL 9. 8. 8. 6.
BR 5. 7. 6. 6.
UN 0.093 0.137 0.116 0.076

Sequences

Field Description
UTR seq + 25 gaugaugugugccgaauauuaguggguaauaagaaugacgacccugagcggaaggugguggagacggaagaugccuacaaauucgccgggcagaugggcauccaguuguucgagaccagcgccaaggagaaugucaacguggaagagauguucaacugcaucacggagcugguccuccgagcaaagaaagacaaccuggcaaaacagcagcagcaacaacagaacgauguggugaagcucacgaagaacaguaaacgaaagaaacgcugcugcuaATGGCCCGGGACTACGACCACCTCT
UTR dot + 25 ((((.(((.((((((((.((.(((((((……….(.(((((……..)).))).)……….)))))))))))))….)))).)))..))))…(((((((.(((((((.((.((..(((((((………..)))))))..))…….)).)))))))…)))))))……….(((((……(((((((((………….(((.((((…)))).)….))……………)))))))))……)))))……………
RS 1 seq AUUACUUUCGCCGCCGAAGGUAGCAGCAUUCGCUGCUUUAAUAGGGAAUCCGGUGUAAGUCCGGAACAGUCUCCGCUGCUGUAAGUUCUUUGGUGAAUGGUGAAGGGUCAAUGGUGAAAGAGCUGCUCAAUUUUUGAGUUUCGCUAUUAAUUUCGAAAUCCGCAAAGCCGGGUGCUAUUGACCAUUGACGAUUGACCAUUCACCGCUGUUGCAACUCCAUACCACUGACCCGGCAUCCGGGACGGGAAGGUCGCCAACAGGGAACAAGUCAGAAGACCUGCCUUACAAUACCAUUUACU
RS 1 dot ..((((((((….))))))))(((((….)))))…………(((((…….)))))(((((…….)))))………((((((((((.((..(((((((((.((..(((.((((…(((((.((((((……….))))))…)))))..))))))).)).)))))))))..)).)))))))))).(((((((.(((……(.(((.(((((…))))).))))..))).)).)))))((..((.(((….))).))))……………..
RS 2 seq AUUAAAUACACUUUUUCAGGUGCCGUUUAUCGGAGAAUAGGGAAUCGGGUGUAAUCCCCGAACGGGCCCGCCACUGUAAUGAACAGUGACUGUCACACGCCACUUCACAUUCCAAUGUAGAGGGAAGGCGGCAGUCACGCAAGAAAGCAACCGCGUUGCGUUAACUGCGUAAGCAGUUAUUAAGCCGCGAAAGAAAGUUUCCUUUAAAGCAUAAUACCAACGAUUCAAGGGAUUAUGAACAGUCUAACUUUCUUGAGCUGAAUGUCUAAGUCAGGAGACCUGCCUGGAGAAUCAGAAUAUU
RS 2 dot ……..(((((….)))))..((((((.(.((….(((..(((((.(….))))))…..)))….)).).)))))).((((((((….((((.((((((((….)))).))))…))))))))))))……..(((((…)))))..(((((((….)))))))……..(..(((((((((……….(((((..((……….))..)))))……..)))))))))..)((((.(.((((.(.((((…))))).)))).).))))……
RS 3 seq AUUGUAGGAUGAGCGUCCGGCCUUGUAUCACAAGUCAAAAGGGAAUCCAGUGUAAAUCUGGAGCUGACGCGCAGCGGUAAGGAAUGCCCGAGCGAUAGCAUUAUUGCAGACACUGUUAUGUACUCUAAAUAUUUCGAGUUGUAGGACAAAACGUUAACGUUUUGAACAGCGCACAUGCAACUUGAAGUAUGCUGGGUAUCGAUGGGAAGUCAUCGCUUUCGUUGUAUCCCCUACUGUUGUUGACGGUUUGUGGUAACAACGGCAUCCAAGCCCGAAGACCUGCCGGAAUACGUCGCAAUUG
RS 3 dot …((.((((….)))).))(((((…)))))…….((..(((((…….))))).))…..(((((((((.((.((((.((((((((…………(((.(((((..((((((…((((((((((((((((..(((((((….)))))))..)……..)))))))))))))))…)))))).)))))…))))))))..)))..)))).)).))))))))).((((..((.(((((…..(((……)))……..))))).))..))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table