Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087478 Similarity: 0.912 Similarity: 0.909 Similarity: 0.903
UTR: 5HSAA087478
Gene: RAB35_1
MFE: -68.520
ENS: 0.915
Length: 278.
Predicted Ligands:
cobalamin - 17/20
unknown - 1/20
FMN - 1/20
 RS: URS00023328AF_1232866
MFE: -103.568
Ligand: cobalamin
Species: Caballeronia udeis Cobalamin riboswitch
 RS: URS00000761C5_326424
MFE: -143.682
Ligand: cobalamin
Species: Frankia alni ACN14a Cobalamin
 RS: URS0000D6C03D_712411
MFE: -108.536
Ligand: unknown
Species: Olsenella sp. oral taxon 807 raiA RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087478 URS00023328AF_1232866 URS00000761C5_326424 URS0000D6C03D_712411
Length 278. 278. 279. 276.
Similarity - 0.912 0.909 0.903
Ensemble Norm 0.915 - - -
MFE -68.520 -103.568 -143.682 -108.536
Ligands - cobalamin cobalamin unknown
Gene RAB35 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 26.004 32.002 34.
Length SE - 0. 1. 4.
Lev Distance - 104. 103. 106.
UBS 19. 19. 24. 23.
BS 0. 0. 0. 0.
ILL 6. 4. 8. 6.
ILR 7. 5. 8. 8.
H 4. 7. 4. 7.
BL 5. 5. 6. 7.
BR 8. 5. 9. 6.
UN 0.083 0.147 0.043 0.098

Sequences

Field Description
UTR seq + 25 guauuaucgggggacccacggggucauugugguuuacgacgucaccagugccgaguccuuugucaacgucaagcgguggcuucacgaaaucaaccagaacugugaugaugugugccgaauauuagauguucaacugcaucacggagcugguccuccgagcaaagaaagacaaccuggcaaaacagcagcagcaacaacagaacgauguggugaagcucacgaagaacaguaaacgaaagaaacgcugcugcuaATGGCCCGGGACTACGACCACCTCT
UTR dot + 25 …….((((((((((((.(((.(.(((((…))))).).).)).)))..).))))))))….(((.((((….)))).)))……(((((..((((((((….((…((((((…)))))).))..))))))))..)))))…..(((………….(((((……(((((((((………….(((.((((…)))).)….))……………)))))))))……)))))………..))).
RS 1 seq ACUUCGCGAUAGUUUUCUGGUGCUCGCGCGCGGUCUCUGCUGCGCGCAGUUAAACGGGAAGCAGGGAGCAUUGCCGCAACCCCGGCCGUGCCAACCUGCGCUGCCCCCGCAACGGUAAACGAAAAUCGAGCGAUGGGGUUUUAUCCCGGUUCACGCCGGGUUCACGCCACUUCGCACGGUAAAGCCGGCUUCGAAAAACCACUGCAUGGCUACAUCAUGCGGGAAGGUGGAGCGGCACUUUCGCCAGCCCGGAUACCGGCCGGAACGAGUCAACACCU
RS 1 dot …………..((((.(((((.(((((((((….))))))))))))…)).))))(((((..((((.((((……)))).))))…)))))…((((((((..((((……..)))).)))..)))))……(((((….)))))((((.((((..((((((.(((..(((((((…………..)).)))))..))).))))))..))))))))(((……)))…((((…….))))……………
RS 2 seq UGGAUAUGUCAUGCUGGCGGACGCGACGGCUUCGGGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGAAGUGCGUCUUCCUGGAUGGGCCCACCGGCGCGACGCGGCGCGGGAGGACACAUCCGGUGAUCGUCGCGCCCGGGCCGGGAAUGAUCUCCCGAUGCCGGGUGGGGCGACGGGUCACGGCCGCGUCAGGCGGCUGGAAGGCCGAGGGCGCGCGCCGAUCCGGGAGCCAGGAUACUCCGGCCGUCGCAGGGUGAUCACCA
RS 2 dot .((((……(((.(.(((((((..(((((((…..)))))))..)))..)))).))))))))………((((((((((…..)))))))).))(((((…(((((((((…(((.(((…….))).)))..))))))))).))))).((..(((((.((((((((((((((.(((..(.((…((((((((((…(((((….)))))..)))))).))))..)).)..)))….))).))))).)))…))).))))))).
RS 3 seq UUUACCCAGGUCUGUGGUUGCGGGAUUCGGCCCCUGCCUUUUCUAGGCGGUCGGUUGAUACCCUAGUCCAUGACAGACGAGGUCAAAGGGAUCCACGUAAGCCGGACGUGAGCGUGCCGGCGAGCAUGGCUCGUCCUAGGAGUAAGUCGCACCGCCCGACGAUAAGCAAGGACGUGGGGUCCUGCGGGCGAGAGAGCCCACGGUGGGGGGCCGUAGCCCCGAAGCCAAAGCCCCGGUGCGCGAGUGUGGGGGAAAAUACCAGGUCAGCUGGGUAAG
RS 3 dot ………(((.(((((((.(((..((((((.((((((…..))))))..))))))..)))))).))))))).(((..(.((…((((((((.((..((((((((….))).)))))..)).)))…)))))..)).)..)))(((..((((.(((………..))).))))..)))((((……))))..(((..(((((….)))))…)))….((((.((((….)))).))))……((((…..))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table