Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087487 Similarity: 0.961 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA087487
Gene: RAB38
MFE: -30.518
ENS: 0.841
Length: 137.
Predicted Ligands:
FMN - 10/20
cobalamin - 5/20
molybdenum - 2/20
 RS: URS0000AB7AA5_1234876
MFE: -31.539
Ligand: FMN
Species: Lactococcus lactis subsp. cremoris TIFN6 FMN riboswitch (RFN element)
 RS: URS0000AB529F_338565
MFE: -41.359
Ligand: molybdenum
Species: Erwinia tasmaniensis Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB37CD_203120
MFE: -38.202
Ligand: FMN
Species: Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087487 URS0000AB7AA5_1234876 URS0000AB529F_338565 URS0000AB37CD_203120
Length 137. 137. 136. 137.
Similarity - 0.961 0.959 0.959
Ensemble Norm 0.841 - - -
MFE -30.518 -31.539 -41.359 -38.202
Ligands - FMN molybdenum FMN
Gene RAB38 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.004 5.012 2.010
Length SE - 0. 1. 0.
Lev Distance - 50. 52. 55.
UBS 6. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 1.
ILR 1. 2. 1. 1.
H 4. 4. 4. 5.
BL 1. 0. 2. 1.
BR 1. 0. 1. 1.
UN 0.175 0.241 0.066 0.277

Sequences

Field Description
UTR seq + 25 ggaaggguacagugauuaauagcccaaauuccagaguugaacugccuccaucuggauccuuacuuuacucugcauguaguaggcaaucuuaggucaagaaagauuuggaaacATGCAGGCCCCGCACAAGGAGCACC
UTR dot + 25 ….((((………….))))….((((((……………))))))………….((((((((…….((((((………))))))…..))))))))((.((……)).))…
RS 1 seq AAAUAUCUUCAGGGCACCGUGUAAUUCGGGACCGGCGGUAAAUAAGGCUUUGACCUUAUGACUCCGCGAUUCGCUACGGCGAUUGAAGCAGUGAAACUCUGCUAGCGACAGUAAAGUCUGGAUGGAAGAAGAUGAAC
RS 1 dot …………((..(((…….)))..)).((((…((((((……))))))….))))…(((((………..(((((…….))))))))))(((……)))……………..
RS 2 seq GUCGGCCGAUCACACUUAAGCUCUGAUACCUGUGUCCUGACGGAUAUGGUGUCAUGGCCGCAACCCUCGAGUUGCCAGGGUGCAGAAAGAAAUGACUGCAUCUCCCGUUUUGGAAAGGUGUCAACGGUGUCACAAU
RS 2 dot ..((((((……………(((((((.((((((….)))))))))))))))))))((((……))))(((((((((((……….))))))))…….)))….(((.((….)).)))…
RS 3 seq UAAUAACUUCAGGGUCGGGUGUAAGUCCCAACCGGCGGUGAGACAUGAAUUUUCAUGGUAAGCCCGCGACCUGCUUUUGCAGCUGAUCUGGUCAAAAUCCAGAGCCGACCGUAAAGUCGGGUAUAAAGAAGUCUAAA
RS 3 dot …………(((.(((…….))).))).((((…..(((((….)))))……))))…((((….))))….(((((…….))))).(((((……)))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table