Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087491 Similarity: 0.946 Similarity: 0.945 Similarity: 0.945
UTR: 5HSAA087491
Gene: RAB3A
MFE: -71.154
ENS: 0.839
Length: 194.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000232E86B_1690483
MFE: -42.751
Ligand: cobalamin
Species: Bacteroidetes bacterium UKL13-3 Cobalamin riboswitch
 RS: URS0002329564_1680155
MFE: -76.879
Ligand: cobalamin
Species: Bradyrhizobium sp. AS23.2 Cobalamin riboswitch
 RS: URS000231EB0D_1144305
MFE: -78.527
Ligand: cobalamin
Species: Novosphingobium sp. AP12 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087491 URS000232E86B_1690483 URS0002329564_1680155 URS000231EB0D_1144305
Length 194. 195. 196. 194.
Similarity - 0.946 0.945 0.945
Ensemble Norm 0.839 - - -
MFE -71.154 -42.751 -76.879 -78.527
Ligands - cobalamin cobalamin cobalamin
Gene RAB3A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 2.001 3.
Length SE - 1. 4. 0.
Lev Distance - 70. 66. 73.
UBS 15. 14. 16. 15.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 4.
ILR 3. 3. 3. 4.
H 5. 5. 5. 5.
BL 7. 6. 7. 6.
BR 3. 4. 3. 3.
UN 0.103 0.174 0.071 0.098

Sequences

Field Description
UTR seq + 25 gugaggcuccgccccucccuuugcaggacgucacggaggacugcaggggccugagccgcugcugccgccgccgccgcgcagccccacaucaacgcaccgggguccugucaccgccaccgccaaaaaagucaccgccgcuagggucgccguugcaucggugcagggcaagATGGCATCCGCCACAGACTCGCGCT
UTR dot + 25 ….(((((.(((((……(((((..(……..)..))))))))))..)))))(((((.((.((….)).)))))))(((………….)))((((((.(((((.((.((……..((.(((……..))).)))).))…)))))))))))….((((….))))…………
RS 1 seq UAUUUUGCACUGCAUUUUGGUUGACAAUCCGCCACAGGCGAAUUUCAUUAAAAGGGAAUCAAGUUUAAAUCUUGAACUAUCCCCGUAGCUGUAAGCUCCGACUAAGUUGUUUAAUCCUCAUGCCACUGUCUUAUGGACGGGAAGGCUUUAAACAAUGGAGCAAGUCAGAAGACCUGCCAGAAUCAAACAUUUAGU
RS 1 dot …(((((.(((…..((((.((…)).))))))))))))………..((((.(((((…….)))))….))))((.((((…)))).)).((..(((((((((…….(((.((((((…))))))…))).)))))))))..))((.(((….))).))……………….
RS 2 seq CCCUACGGUCAUCCCGACGGCUCCCUUCGGGGAUUAAUAGGGAAUGCGGUGCAGGGGAUUGCCCUUAUGCCGCAGCUGCCCCCGCAACUGUAAGCGGUGAACCUCGCGUCAUAUGCCACUGGUAUCUCGGACCGGGAAGGCGACGUAGAGGUCACGACCCGCGAGCCAGGAGACCUGCCGUCAGCCGUGGUCACAC
RS 2 dot (((((.((((..(((((.((…)).)))))))))..)))))..(((((((.(((((….))))).)))))))……..(((……..)))(((.((((((((((….(((.(((((…….)))))…)))))))).))))))))((.(((((.((((((…))))……)))))))))….
RS 3 seq GUUGCCGCCCUUGCGACAGGUUCCCCGCGAGGGGAUCAAAAGGGAACUCGGGUGAAAGCCCCGAGGCUGCCCCUGCAACUGUAAGCGGCGAGCCAUCGGCCAUUACGCCAUUGGGACCCCCUAAGGUCCUGAGAAGGCGGCCGAAUCGGCACUGACCCGUGAGCCAGGAGACCUGCCUGACGCAGUCGUUCUUC
RS 3 dot …….(((((..((…..(((((….)))))))..)))))..((((((.(….)))))))(((((…(((….))).)))))..(((.((((((…..(((.((((((((……))))))))…)))))))))…)))..((((.(((.((.((((…)))).)).)))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table