Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087515 Similarity: 0.985 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA087515
Gene: RAB3GAP1
MFE: -10.455
ENS: 0.755
Length: 82.
Predicted Ligands:
cyclic-di-GMP - 10/20
SAM - 5/20
homocysteine - 2/20
 RS: URS0000AB9921_702450
MFE: -11.781
Ligand: cyclic-di-GMP
Species: Turicibacter sanguinis PC909 Cyclic di-GMP-II riboswitch
 RS: URS0000DB4E38_1497
MFE: -15.398
Ligand: cyclic-di-GMP
Species: Clostridium formicaceticum Cyclic di-GMP-II riboswitch
 RS: URS0000ABB332_913865
MFE: -14.765
Ligand: cyclic-di-GMP
Species: Desulfosporosinus sp. OT Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087515 URS0000AB9921_702450 URS0000DB4E38_1497 URS0000ABB332_913865
Length 82. 83. 83. 83.
Similarity - 0.985 0.982 0.981
Ensemble Norm 0.755 - - -
MFE -10.455 -11.781 -15.398 -14.765
Ligands - cyclic-di-GMP cyclic-di-GMP cyclic-di-GMP
Gene RAB3GAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 2.007 11.007
Length SE - 1. 1. 1.
Lev Distance - 18. 23. 22.
UBS 2. 3. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 1. 0. 0.
H 1. 1. 2. 2.
BL 0. 0. 0. 2.
BR 0. 0. 0. 1.
UN 0.268 0.241 0.349 0.349

Sequences

Field Description
UTR seq + 25 aagcuaugauauuccaaagggcuuaacuagauuagacucuucuuuauuuuuucccaaATGGCTGCCGACAGTGAGCCCGAAT
UTR dot + 25 ………………((((((………………………………((((….))))))))))….
RS 1 seq GAAUUAAAAGAAACGAUGAAGUAUAUUCUGUAUUUGGGCACCUGGAAUAUAUGGAGUUAGUGGUGCAACCGGCUUUAUAAAUU
RS 1 dot ……………(((((((…………((((((((……………….)))))..))))))))))…..
RS 2 seq UAAAAGGAUAGAACAGAAGAACUACAGCUAUAUUUGGACGCUUAAGCUGUAGGGAUGUAGUGGCGUAACCGGCUAACAAUGAU
RS 2 dot …………………((((((((……………))))))))…(((..((((…….)))))))…..
RS 3 seq UGUAAAGAGGAAAUUUUGAAGCAUGUAUCUUAUUUGGGCGCUUGAUACAUGUGGAGUAAGUAGCGCAACCGGCCUGGUUUAUA
RS 3 dot ………………..(((((((((…………..)))))))))…..((.(((.((…..))))).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table