Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087523 Similarity: 0.953 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA087523
Gene: RAB3GAP1_0
MFE: -38.052
ENS: 0.954
Length: 176.
Predicted Ligands:
cobalamin - 13/20
lysine - 4/20
FMN - 2/20
 RS: URS0002312CAA_1121420
MFE: -51.409
Ligand: cobalamin
Species: Desulfosporosinus lacus DSM 15449 Cobalamin riboswitch
 RS: URS00022E1C35_52694
MFE: -32.936
Ligand: cobalamin
Species: Acetobacterium wieringae Cobalamin
 RS: URS0000C0BE07_1618480
MFE: -51.220
Ligand: glucosamine
Species: Candidatus Roizmanbacteria bacterium GW2011_GWA2_36_23 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087523 URS0002312CAA_1121420 URS00022E1C35_52694 URS0000C0BE07_1618480
Length 176. 176. 176. 175.
Similarity - 0.953 0.953 0.953
Ensemble Norm 0.954 - - -
MFE -38.052 -51.409 -32.936 -51.220
Ligands - cobalamin cobalamin glucosamine
Gene RAB3GAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 18.001 30.001 4.
Length SE - 0. 0. 1.
Lev Distance - 56. 52. 61.
UBS 8. 11. 12. 8.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 3.
ILR 2. 4. 3. 3.
H 4. 5. 4. 4.
BL 0. 2. 2. 1.
BR 1. 1. 4. 0.
UN 0.165 0.199 0.199 0.166

Sequences

Field Description
UTR seq + 25 ucaauuuguucaucacuuucaccugcugagguuggugauauaauuuauauuuauuucuguucuuuuuauagaaacugcugauauaacucaugcuuugucaaaauugacagagccggcaucaguuccaauucauaaauuaucaguuucaaauATGGCTGCCGACAGTGAGCCCGAAT
UTR dot + 25 ………..((((((…((((….)))).))))))…………..(((((((…….))))))).(((((………..(((((((((….))))))))))))))…((((…(((((…….(((((……..)))))……)))))…))))
RS 1 seq AUUAAUAAUUUUUUCUUAGGUGCCCUGUAAAGGGAGAAUAGGGAACCGGGUGUAAGUCCCGGACGGGCCCGCCACUGUAUAGGUUAGCCGAUGCCAACAACCACUCCAAAGUUGGGGGAAGGGGCAUAAUGGCGAUGAUCCUGAGUCAGGAGACCUGCCUAAGAUAAGAGUGACCU
RS 1 dot ………..(((((((..(.((((….)))).)..)))))))(((((…….)))))…(((..(((……..)))..))).(((((…..((.(((((….)))))…)))))))…((((….(((((…)))))….))))……………..
RS 2 seq AUUAAAUAAUCAUUUUCAGGUGCCCCUCGGGGAGAAUAGGAAAAUAAGUGAGAAGCUUAUACGGGCCCGCCGCUGUAAAUUGGGAAUUGCUGUCUGGAUGCCACUGUUAAAAAAUGGGAAGGCGACAGCGAUGAGGAUCAUGAGUCAGAAGACCUGCCGGAGAAUUAGAUGAUGAG
RS 2 dot ………..((((((..((.((((…))).).))..))))))………..((((((((…..))).)))))…….(((((((((…..(((.(((((….)))))…))))))))))))…..((((..(((……((….))…….))).)))).
RS 3 seq UAUAAACAAAAAGCGUGCGGCCCCGAGGACUCGGGGAAACGAGGAGAAGGUAAUUCGAAAAUCCCGGAAUUUACGGGAUUAAUCAGCGGGUACCUUCAAGAUGGAGUUAUCAUCUUAAAUGUUUUCCAUAAAAACUUAAGGCAACUUAAGCGACAAAAGGAAAACAAAUAACUAC
RS 3 dot ………….(((….((((((….))))))..)))….((((((.(((((..(((((((…….)))))))……)))))))))))(((((((…..)))))))…((((((((…….((((((….))))))……..))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table