Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087598 Similarity: 0.985 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA087598
Gene: RAB41
MFE: -20.503
ENS: 0.836
Length: 71.
Predicted Ligands:
homocysteine - 14/20
2'-dG-II - 3/20
fluoride - 2/20
RS: URS0000C86615_1714344
MFE: -20.177
Ligand: homocysteine
Species: Curvibacter sp. PAE-UM S-adenosyl-L-homocysteine riboswitch
RS: URS0000D7CCB0_1802374
MFE: -23.069
Ligand: homocysteine
Species: Thiobacillus sp. GWE1_62_9 S-adenosyl-L-homocysteine riboswitch
RS: URS0000D921CB_1660145
MFE: -19.969
Ligand: homocysteine
Species: Thiobacillus sp. SCN 63-57 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087598 URS0000C86615_1714344 URS0000D7CCB0_1802374 URS0000D921CB_1660145
Length 71. 71. 71. 71.
Similarity - 0.985 0.985 0.984
Ensemble Norm 0.836 - - -
MFE -20.503 -20.177 -23.069 -19.969
Ligands - homocysteine homocysteine homocysteine
Gene RAB41 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 10.024 10.024
Length SE - 0. 0. 0.
Lev Distance - 19. 17. 18.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 0. 0. 0. 0.
H 3. 3. 2. 2.
BL 1. 1. 3. 3.
BR 2. 0. 0. 0.
UN 0.028 0.042 0.183 0.183

Sequences

Field Description
UTR seq + 25 caggcugagcguuggaagccauuuuggcugcaaccuaccugaagcgATGTCTGCCTTTGGTCACGACGAGG
UTR dot + 25 ((((…((.((((..(((((…))))).)))))).))))..(((…..)))(((((…….)))))
RS 1 seq CAAUCCAAGGAGCGUUGCAGCAGCACGGACCGUGUUGUCAGGCUUGGAUGUCCCAACGACGCUCACCUGCC
RS 1 dot ..(((((…(((.(((..((((((((…)))))))))))))))))))(((…..)))((……)).
RS 2 seq GGUUCUGAGGAGCGCUGCGACGGGUCACCCGCCAGGCUCAGAACGCUUCCUUUCAACGGCGCUCACGUUUU
RS 2 dot .(((((…((((.(((.(.((((…)))))))))))))))))……….((((…….))))..
RS 3 seq GGUUCUGAGGAGCGCUGCGACGGUUCACCCGCCAGGCUCAGGACGCUUCCUUUCAACGGCGCUCACGUUUU
RS 3 dot .(((((…((((.(((.(.(((…..))))))))))))))))……….((((…….))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table