Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087780 Similarity: 0.982 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA087780
Gene: RABGGTA
MFE: -30.860
ENS: 0.843
Length: 104.
Predicted Ligands:
SAM - 11/20
TPP - 8/20
purine - 1/20
 RS: URS0000C72033_1128398
MFE: -20.432
Ligand: TPP
Species: [Clostridium] acidurici 9a TPP riboswitch (THI element)
 RS: URS0000C5E5D5_46677
MFE: -29.737
Ligand: TPP
Species: Pseudomonas agarici TPP riboswitch (THI element)
 RS: URS0000C82ECF_1697053
MFE: -25.672
Ligand: TPP
Species: Oblitimonas alkaliphila TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087780 URS0000C72033_1128398 URS0000C5E5D5_46677 URS0000C82ECF_1697053
Length 104. 103. 105. 102.
Similarity - 0.982 0.977 0.976
Ensemble Norm 0.843 - - -
MFE -30.860 -20.432 -29.737 -25.672
Ligands - TPP TPP TPP
Gene RABGGTA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 7.015 6.001
Length SE - 1. 1. 4.
Lev Distance - 21. 27. 25.
UBS 10. 9. 8. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 1.
ILR 5. 4. 4. 4.
H 2. 2. 1. 2.
BL 2. 3. 2. 3.
BR 3. 2. 3. 3.
UN 0.038 0.078 0.162 0.010

Sequences

Field Description
UTR seq + 25 uucgaugagccgggacguggcgcagacuucaagggcuaccacuggacccuuccccugucuugaacccugagccggcaccATGCACGGACGCCTGAAGGTGAAGA
UTR dot + 25 (((((((.(((((..((.((..(((((…((((((((….))).)))))…..)))).)..)).))..)))))..)))…))))((((….))))….
RS 1 seq AUUACGUCCUAGGGGAGCUAUUUAGCUGAGAGGAAACUGAAAGUUUUGACCCUUUGAACCUGAUCUAGUUAACACUAGCGUAGGGAAGCGAUGAGUUUGUGUU
RS 1 dot .(((((..(((((..(((((.((((.(.((((((((((…)))))….))))).)..))))..)))))..).)))))))))..((((…..))))…..
RS 2 seq CAGUUCUUGUCGGGGUGCCUUGCAAUAGGCUGAGAUCGGAUAAUUCCGGAUCCCGUUGAACCUGAUCAGGUUAGCGCCUGCGUAGGGAACAAGAUUGCUCGUCCC
RS 2 dot ..((((((..((((((((((((…((((.((.(((((((….)))).))).))…..))))..))))…)))))).))..))))))……………
RS 3 seq UUGUUCUUGUCGGGGUGCCAUUAUGGCUGAGAUUGGUAAUAACCAGAUCCCGUUGAACCUGAUCGGGUUAAGACCCGCGUAGGGAACAAGAUAAGCGUGUCA
RS 3 dot ((((((((..(((((((((((((.((.((.(((((((….))))).)).))…..))))))..)))….)))).))..))))))))((((….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table