Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087803 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA087803
Gene: RABGGTA_0
MFE: -31.731
ENS: 0.987
Length: 93.
Predicted Ligands:
tetrahydrofolate - 6/20
glycine - 4/20
TPP - 3/20
 RS: URS0000AB28D8_575594
MFE: -30.442
Ligand: tetrahydrofolate
Species: Lactobacillus coleohominis 101-4-CHN THF riboswitch
 RS: URS0000AB6C74_465543
MFE: -27.942
Ligand: TPP
Species: Streptomyces sp. SPB74 TPP riboswitch (THI element)
 RS: URS0000C3283C_887896
MFE: -28.242
Ligand: tetrahydrofolate
Species: Lactobacillus coleohominis DSM 14060 THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087803 URS0000AB28D8_575594 URS0000AB6C74_465543 URS0000C3283C_887896
Length 93. 94. 93. 94.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.987 - - -
MFE -31.731 -30.442 -27.942 -28.242
Ligands - tetrahydrofolate TPP tetrahydrofolate
Gene RABGGTA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 6. 10.
Length SE - 1. 0. 1.
Lev Distance - 18. 21. 19.
UBS 8. 6. 9. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 2. 2. 2. 3.
H 1. 1. 1. 1.
BL 5. 4. 5. 3.
BR 3. 3. 5. 2.
UN 0.097 0.106 0.108 0.106

Sequences

Field Description
UTR seq + 25 acacgcacgcuacagucgcccgugcgcacucguacacaccagguggcuaacagguacgaggcguuuccATGCACGGACGCCTGAAGGTGAAGA
UTR dot + 25 …..(((.((.(((.((.((((((((.(((((((…..((….))…..)))))))))……..)))))).)).))).)))))….
RS 1 seq GUUGGGGUAGGAACGACUGGGUUACUGUCCACCGGAACGGAAUGUGAACGGUGGAAGAAGGCUUUGGUCGCCUUGUGGUUCCGCAUUCACCACU
RS 1 dot ….((((.(((((.((.((((.(((((((((((…………..)))))))………)))).)))).)).)))))..))))……
RS 2 seq UCACCGGACACGGGGUGCCCCGCGGGGGCUGAGAUCACACCCGUCGAACCUGAACCAGCUCGUACUGGCGGAGGGAUGUCUUCCAUGUCAUUG
RS 2 dot ……((((.(((((.((((((.(((((((.(.(((………….))).))))))….)).)))).)).))….))).))))….
RS 3 seq GUUGGGGUAGGAACGACUGGGUUACUGUCCACCGGAACGGAAUGUGAACGGUGGAAGAAGGCUUUGGCCGCCUUGUGGUUCCGCAUUCACCACU
RS 3 dot ….((((.(((((.((.((((..((((((((((…………..)))))))………)))..)))).)).)))))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table