Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087932 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA087932
Gene: RACGAP1
MFE: -31.996
ENS: 0.872
Length: 136.
Predicted Ligands:
molybdenum - 6/20
cobalamin - 6/20
glycine - 4/20
 RS: URS0000DA81D4_505341
MFE: -31.980
Ligand: molybdenum
Species: Gallibacterium salpingitidis Moco (molybdenum cofactor) riboswitch
 RS: URS000081C612_141349
MFE: -43.725
Ligand: cobalamin
Species: Mycobacterium lentiflavum Cobalamin
 RS: URS00004B7D39_1432552
MFE: -42.318
Ligand: molybdenum
Species: Klebsiella pneumoniae IS43 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087932 URS0000DA81D4_505341 URS000081C612_141349 URS00004B7D39_1432552
Length 136. 135. 137. 139.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.872 - - -
MFE -31.996 -31.980 -43.725 -42.318
Ligands - molybdenum cobalamin molybdenum
Gene RACGAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.005 14. 2.001
Length SE - 1. 1. 9.
Lev Distance - 35. 34. 29.
UBS 9. 7. 11. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 4. 3. 7. 3.
H 3. 2. 3. 3.
BL 3. 4. 4. 4.
BR 1. 2. 1. 1.
UN 0.125 0.193 0.124 0.151

Sequences

Field Description
UTR seq + 25 guacgucacaccguagagggacggcgcgggaggaauaaauuucucugugauugguuggugaagguuuucaaaccggagcugugggcgcggcgcugcucugccguuggaaagATGGATACTATGATGCTGAATGTGC
UTR dot + 25 ……….((((……))))(((.(((((((….)))))))))).((((((((((.(..(((((((..((((((.(((…….))).))))))…)))))))..)…)))))….)))))……
RS 1 seq UUUUUUCGCAUACUCCGAGCUAGUUUACCUAAGUCGAUAGAUAAGGUGGCUAUGCCAAACACAUUAAGUGUUUCACGGAUAGAUUGGAAACGGUCUAUCCCCUCGUAUUUAGAAAGGUGUUUAUGCAACAAUAUA
RS 1 dot ……………..(((((.((((.(((……))).)))).))))).(((.((((((.(((((((……((((((((((….))))))))))…..)))))))….))))))..)))……..
RS 2 seq GCAAUAUCGGCUACCGACAGUGCGCCGACGGGCCUGCACGAAGAGGAAACCGGUGCGAAUCCGGUGCGGUCCCGCCACUGUGAUCGGGCACAUUGCGACCCGAGAGCCAGAUACUCACCGCCGGCGCUUCCUAGACG
RS 2 dot ……((((…))))..(((((((….)))..))))….(((((.((((((.(((((.(((.(((…(((…((((……))))..)))..)))…))).)))..))..))))))…)))))…..
RS 3 seq AUAACCUGUUAACACUCUAGCCUCUUCGCCUGUGUCAAAAGAUAUGGCGAUUUGGCCGCGACGCCGCCGGUUGUCGCCAGGGCGUGGAAAGAAAUGACCGCGUCUCCCGUAUUUGGAAAGGUGUAUAUGGCCUCACAGC
RS 3 dot …….((((……))))….(((((.(((((….))))))))))…(((((..(((((.((((.((.((…((((((((……….))))))))..)))).))))…)))))…)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table