Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087949 Similarity: 0.953 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA087949
Gene: RACGAP1_0
MFE: -55.840
ENS: 0.830
Length: 165.
Predicted Ligands:
Mg2+ - 4/20
FMN - 4/20
SAM - 4/20
 RS: URS0000C12583_1294142
MFE: -34.196
Ligand: Mg2+
Species: Clostridium intestinale URNW M-box riboswitch (ykoK leader)
 RS: URS0002326594_499207
MFE: -37.013
Ligand: cobalamin
Species: Syntrophaceticus schinkii Cobalamin riboswitch
 RS: URS0000DAF111_1235794
MFE: -61.632
Ligand: FMN
Species: Enterorhabdus caecimuris B7 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087949 URS0000C12583_1294142 URS0002326594_499207 URS0000DAF111_1235794
Length 165. 166. 166. 163.
Similarity - 0.953 0.951 0.951
Ensemble Norm 0.830 - - -
MFE -55.840 -34.196 -37.013 -61.632
Ligands - Mg2+ cobalamin FMN
Gene RACGAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.006 10.001 7.
Length SE - 1. 1. 4.
Lev Distance - 59. 60. 57.
UBS 10. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 2.
ILR 1. 1. 3. 2.
H 6. 5. 6. 5.
BL 4. 3. 3. 4.
BR 2. 4. 2. 2.
UN 0.164 0.241 0.133 0.178

Sequences

Field Description
UTR seq + 25 gcucugccguugggugaggcgcggagcgaagugaaggguggcccagguggggccaggcugacugaagugaguagugggggugccagaccaggugcgucugccgcuggauugugauaggaagcagaguguucgugugaaagATGGATACTATGATGCTGAATGTGC
UTR dot + 25 ((((((.((((……))))))))))………..((((((…..)))))).(((.((….)).))).(((((.(((((……))))).)))))(((……)))……((((.(((((((((…….)))))))))….))))……..
RS 1 seq AAAUAUUAUAUUUUUGUGAGGCUCCUACAUAGACACACGCUACUGCCCAGAAACAUCGAGAGAUGCCAACGGGUCAGGAGGUAUUAUCGAAAGAAGGUAUUACCUAAUGUAGCUAGAGAAUUAACUCUUAAGCUUUGUAGUGCUAAAACUCAGAAUUAAAGUUAAU
RS 1 dot …………((((((((….)).))))))………((((((…..((((….))))…..))).))).(((((.((((…….)))).)))))……(((.((((……)))).)))((((.(((……)))))))…………
RS 2 seq AAAUAUUUACUGGUAUACGGUUGCACAUUGUGCAUUAAAAGGGAACAUGGUGAAAAACCAUGACAGCCCCCGCUACUGUAAGAAGGACAGCCCCCUCAAUGAAUAUAGCAGGAAAAGGGCGCUGGAUGAUUUCGAGUCAGGAACCUGCCUUAUGCCAUCACAUAGU
RS 2 dot ……..((((…..))))(((((…)))))……(((..((((((…..))))))….)))((.((……))..)).((((.((((……………….)))).))))((((…..(((.(((….))).)))….))))…….
RS 3 seq AUUCUGUUUCAGGGCGAGGUGGAAAUCCUCACUGGCGGUAAGCACGGCGGCGCAUCCGAGCGCUUCCGGCAAGCCCGCGACCCUGCGAAGCCCAUGCGGCUUCCAGGCUGACCCGGUGAAAAUCCGGGGCCAACGGUUACAGUCCGGAUGGAAGAGGCAGAUG
RS 3 dot ………(((…((((…….)))).)))((((…((.(((.(((((……))))).)))))….))))…((((.((((((…..))))))))))….(((((…….))))).(((.(((…….)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table