Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088108 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA088108
Gene: RAD51
MFE: -23.067
ENS: 0.931
Length: 74.
Predicted Ligands:
homocysteine - 5/20
fluoride - 4/20
cobalamin - 3/20
 RS: URS0000D8F731_67267
MFE: -28.822
Ligand: cobalamin
Species: Streptomyces alboflavus Cobalamin riboswitch
 RS: URS0000D9A1FF_1817759
MFE: -31.531
Ligand: glycine
Species: Candidatus Muproteobacteria bacterium RBG_16_65_31 Glycine riboswitch
 RS: URS0000C1FB49_1549812
MFE: -20.243
Ligand: homocysteine
Species: Massilia sp. BSC265 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088108 URS0000D8F731_67267 URS0000D9A1FF_1817759 URS0000C1FB49_1549812
Length 74. 76. 74. 73.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.931 - - -
MFE -23.067 -28.822 -31.531 -20.243
Ligands - cobalamin glycine homocysteine
Gene RAD51 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 7. 5.
Length SE - 4. 0. 1.
Lev Distance - 18. 21. 21.
UBS 7. 7. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 0. 1. 1. 0.
H 2. 2. 2. 2.
BL 3. 3. 1. 3.
BR 3. 3. 2. 1.
UN 0.095 0.132 0.108 0.110

Sequences

Field Description
UTR seq + 25 cuugggagucguggucuucgaucugguaaacagaagacggcaacucguaATGGCAATGCAGATGCAGCTTGAAG
UTR dot + 25 .(((.((((.((.((((….((((…..)))))))).)).)))).))).(((..(((….))))))…..
RS 1 seq GGGGAAUCUGGUGCGAACCCAGAGCUGACGCGCAGCGGUGUGGACCGGCAGGGAGCCGGGCCGAGCCCGAAUGCCC
RS 1 dot …….(((((.((.(((….((((…..))))))).)).)))))..((.(..(((((…)))))..).)).
RS 2 seq CGUCUCUGGAGAGCGGUCGGCUGCUGCCGACCCACCGAAGGGGCUCAAGCUCUCAGGUCACAGGACAGAGGGGG
RS 2 dot .((((((((…(.(((((((….)))))))).))..))))))…..(((((..(((….))).)))))..
RS 3 seq GAUUCCGAGGAGCGUUGCGACGAAGAUUCCCAUCUUCGCCAGGCUCGGAUAUCAGCAACCGCGCUCACGUUAC
RS 3 dot ((((((…((((.(((.(.(((((((….)))))))))))))))))).)))(((……)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table