Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088118 Similarity: 0.946 Similarity: 0.945 Similarity: 0.945
UTR: 5HSAA088118
Gene: RAD51AP1
MFE: -49.914
ENS: 0.832
Length: 181.
Predicted Ligands:
cobalamin - 11/20
lysine - 6/20
zmp-ztp - 1/20
 RS: URS00023256E5_1254432
MFE: -70.861
Ligand: cobalamin
Species: Sorangium cellulosum So0157-2 Cobalamin riboswitch
 RS: URS000231F45D_448385
MFE: -72.446
Ligand: cobalamin
Species: Sorangium cellulosum 'So ce 56' Cobalamin riboswitch
 RS: URS00023285DE_1736490
MFE: -71.367
Ligand: zmp-ztp
Species: Hydrogenophaga sp. Root209 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088118 URS00023256E5_1254432 URS000231F45D_448385 URS00023285DE_1736490
Length 181. 181. 181. 181.
Similarity - 0.946 0.945 0.945
Ensemble Norm 0.832 - - -
MFE -49.914 -70.861 -72.446 -71.367
Ligands - cobalamin cobalamin zmp-ztp
Gene RAD51AP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.013 6.004 14.016
Length SE - 0. 0. 0.
Lev Distance - 66. 70. 66.
UBS 15. 16. 14. 17.
BS 0. 0. 0. 0.
ILL 1. 4. 2. 3.
ILR 2. 3. 1. 4.
H 6. 6. 7. 5.
BL 4. 4. 5. 4.
BR 4. 4. 3. 5.
UN 0.182 0.066 0.116 0.055

Sequences

Field Description
UTR seq + 25 acagcgcgugcgccgccgcaagcauggcuggugaugauuggacgacugguaacagggggcggagggcuccgaagucugguuuugggcgggaauugaaaccgccgcugaagccaacaagaauuugagaacuguaaauaccaagccuugaaagggaccATGGTGCGGCCTGTGAGACATAAGA
UTR dot + 25 .((((.(((((((….))..)))))))))……………(((….)))(((((…..)))))…((.(((((((((((((………))))).).)))))))))………….((((….((((.(((((…)))).)..))))))))(.((((…)))).).
RS 1 seq CGCUGGUGCCUGGGCGCUCGCUCAGGCUGAAUAGGGAACCCGGUGAGAUUCCGGGGCUGCCCCGCAGCGGUAAGCGAGAACGACCUCCACCCCAUGCACUGGCCCGAUGAGGGCUGGGAAGCGGUGGACAGUAGGAAGCCGGCCCGGCCGGAGCGCUCGCGAGCCCGAAGACCUGCCCGCG
RS 1 dot (.(((..((((((((….))))))))….))).)..(((((…….)))))(((((…)))))(((…((….)))))((((((….((.(((((((…..)))))))…))))))))………((.(((..((((((.((……..)))))..).)).))).)).
RS 2 seq UGCUGGUGCCCGGGCGUUCGCCUGGGCCGAAGAGGGAACCCGGUGAAACUCCGGGGCUGCCCCGCAGCGGUAAGCGAGAACGACCUCCACCCCAUGCACUGGCCCGCCGAGGGCUGGGAAGCGGUGGACAGUAGGAAUCCGGUCAGACCGGAGCGCUCGCGAGCCCGAAGACCUGCCAGCG
RS 2 dot …(.(.((((((((….))))))))).)……..(((((…….)))))(((((…)))))(((…((….)))))((((((….((.(((((((…..)))))))…))))))))………((((((…)))))).((((.(((.(……..).))).))))
RS 3 seq CGCCGAGUACGCAACUGGCGAUAGGCGCGCAACCCUCGGAUCGAUCCGGGAGGUCUGCCGCUGACGUGGCCCCCCUGCCCGAUCACACCCAACAUCGAUCUGCGGCCGGGACAACCACUGGGAAGCGUGCCACCCCAGCUGAUGCAGCGCGGGUGUUCAGCCGUUCGCCUGGGCAGCCCUU
RS 3 dot ((((.(((…..)))))))…((((.((((((((((((….)))))).))).)))))))…((((…(((.((((((((…………)))).).))).)))….)))).((..((((.(((((((..((((…))))..)))))….))))))..)).(((…)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table