Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088284 Similarity: 0.956 Similarity: 0.956 Similarity: 0.955
UTR: 5HSAA088284
Gene: RAD9B
MFE: -48.135
ENS: 0.833
Length: 163.
Predicted Ligands:
cobalamin - 9/20
SAM - 6/20
FMN - 3/20
 RS: URS0002316087_1302241
MFE: -55.116
Ligand: cobalamin
Species: Propionibacterium acnes JCM 18909 Cobalamin riboswitch
 RS: URS0000C30C18_1300347
MFE: -75.464
Ligand: SAM
Species: Nocardioides dokdonensis FR1436 SAM riboswitch (S box leader)
 RS: URS0000C74A41_1679170
MFE: -36.229
Ligand: SAM
Species: Bacillus sp. FJAT-27997 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088284 URS0002316087_1302241 URS0000C30C18_1300347 URS0000C74A41_1679170
Length 163. 161. 163. 164.
Similarity - 0.956 0.956 0.955
Ensemble Norm 0.833 - - -
MFE -48.135 -55.116 -75.464 -36.229
Ligands - cobalamin SAM SAM
Gene RAD9B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 9. 9.001
Length SE - 4. 0. 1.
Lev Distance - 51. 55. 55.
UBS 11. 10. 13. 11.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 3.
ILR 2. 2. 4. 2.
H 3. 3. 3. 4.
BL 4. 3. 4. 2.
BR 5. 4. 4. 3.
UN 0.110 0.186 0.104 0.146

Sequences

Field Description
UTR seq + 25 aaagccguuugggaacuuguggaggcggggugguagagugcagagacgagaucgcgaagcuuugaaaagcgcgggcaacauccgggcaccugggccgucgagcugaggcgcgccuuccgagccugcuuuuuagggcggATGAGTGAAAATGAACTTGACACAA
UTR dot + 25 …….((((.((.(((((….(((………..)))….))))).)).))))((((((((((((..((((…….((((.(((.(((……))).))).)).))……))))))))))))))))….((((……..))))…….
RS 1 seq GCUAAAGUACCGCCGUCUGGAGCAGGGAACCCCGUGAGAAUCGGGGACUGACGCGCAGCGGUAACGCAGACGGGCGAGUAGCAAGCCACUGGGAACACCCCGGGAAGGCGCUCGUUCGGAUGAUGCCAAGUCCGAAAACCUCCCGGACCACACUUACCCGA
RS 1 dot …….((((((.((.((…(((….(((((…….))))).))).)).)).))))))…((..(((((((((…..(((.(((((…..)))))…))))))))))))..))…….(((((………)))))………….
RS 2 seq AGCUCAUCAAGAGGGACUGAGGGAACGGCCCGUCGACGUCCCGGCAACCGCCACGAUCCUCCGCCCACCGGGCGGUCCGCACCUGCGGCCCGCCUGCGACAGCGGUUCGUGGAAACGGUGCUACAUCCGGCCCGGUGCGAAGGACGCCCGGGGAAGAUGAGGA
RS 2 dot …………((((((((.((……)).)))..)))))(((.((((((((((….((((…((((((((.((((….)))).))))))).)…)))).))))))…))))))).((((…(((((.(((…..))))))))…))))….
RS 3 seq CUCUUAUCCCGAGUUGGUGGAGGGACAGGCCCUAAGAAACCCAGCAACCUGCCGAAGUGUAGAAAGUUUGCGAAAGAUUUAUUGCAAUUAAAAGCAAUUCUCUUUUAAUAAUUUUGGCGUUGGUGCUAACCUGAGCAAGGUAAAAAACCCUUGAACGAUAAGAG
RS 3 dot …………((((.(((((((…..))))…….))).))))..((((((((((.(((((……..(((…(((((……..))))))))))))).))).)))))))…(((….)))((..(((((……..)))))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table