Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088286 Similarity: 0.969 Similarity: 0.969 Similarity: 0.967
UTR: 5HSAA088286
Gene: RAD9B_0
MFE: -39.053
ENS: 0.960
Length: 124.
Predicted Ligands:
cobalamin - 9/20
glycine - 3/20
GMP - 2/20
 RS: URS0000AB19CB_999541
MFE: -56.483
Ligand: guanidine
Species: Burkholderia gladioli BSR3 Guanidine-I riboswitch
 RS: URS0000AB5E07_246196
MFE: -38.126
Ligand: cobalamin
Species: Mycobacterium smegmatis str. MC2 155 AdoCbl riboswitch
 RS: URS0000D6A33B_12908
MFE: -48.167
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088286 URS0000AB19CB_999541 URS0000AB5E07_246196 URS0000D6A33B_12908
Length 124. 123. 124. 125.
Similarity - 0.969 0.969 0.967
Ensemble Norm 0.960 - - -
MFE -39.053 -56.483 -38.126 -48.167
Ligands - guanidine cobalamin GMP
Gene RAD9B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 12.001 7.
Length SE - 1. 0. 1.
Lev Distance - 38. 37. 41.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 4. 3.
ILR 1. 2. 1. 3.
H 3. 4. 3. 3.
BL 3. 4. 1. 2.
BR 3. 2. 5. 2.
UN 0.113 0.073 0.081 0.120

Sequences

Field Description
UTR seq + 25 gcagagacgagaucgcgaagcuuugaaaagcgcgggcaacauccgggcaccugggccgucgagcugaggcgcgccuuccgagccugcuuuuuagggcggATGAGTGAAAATGAACTTGACACAA
UTR dot + 25 ((.((…….))))…((((((((((((..((((…….((((.(((.(((……))).))).)).))……))))))))))))))))….((((……..))))…….
RS 1 seq UCUUAGGGGUGCUAGGGUUCCGGUCGCGCGCGAGUGCGAUGCCUGGUCCGAGAGCAGCCCGGCACGGGCCGGCGCGCGAUGCGCGGGACACGUGCUACACGGCGGGACAAAAGCCCGGGAGAG
RS 1 dot .(((((…..)))))(((((((((((((((..((.((.((((.(((………))).)))))).))..)))))))))…)))))).((((…)))).((((.(….)))))……
RS 2 seq AUGCUGCUGUAAUCGACAGACGCCGGAAUCUGGUGAGAAUCCAGAACGGUCGCGCCACUGUGAAAGUCAGACCCUGCGUUUGUCACUCCUUCGAACUGGGACGCGGUAUCCCAGAAAGGAUCUU
RS 2 dot .(((….)))…(((((((((.((..(((((……(((((…(((…))).))).))…))))).)).)))))))))..(((((….((((((…….)))))).)))))….
RS 3 seq UGACACCACGGACGCAUCGAUCCUCGGGUAGAGGUUCCAGACGGUCGCCCAUCGGGUUGGGGCUGUUCCAGCGCCAACCGCCGGUGACCCGGGGGGAGCGAAUGGCGAGACCGGCCGUGAGAUGA
RS 3 dot ..((.((..(((((…)).)))..))))….(((((….(((((((…..((((((.((((…)))).))))))…)))))))…..)))))..(((((…….)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table