Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088674 Similarity: 0.964 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA088674
Gene: RAP1A
MFE: -32.940
ENS: 0.875
Length: 143.
Predicted Ligands:
FMN - 11/20
cobalamin - 8/20
glucosamine - 1/20
 RS: URS000231823E_696747
MFE: -42.504
Ligand: cobalamin
Species: Arthrospira platensis NIES-39 Cobalamin riboswitch
 RS: URS000232D785_1679168
MFE: -36.448
Ligand: cobalamin
Species: Bacillus sp. FJAT-27231 Cobalamin riboswitch
 RS: URS0002334F45_1839780
MFE: -63.297
Ligand: cobalamin
Species: Streptomyces sp. MnatMP-M17 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088674 URS000231823E_696747 URS000232D785_1679168 URS0002334F45_1839780
Length 143. 145. 143. 145.
Similarity - 0.964 0.964 0.964
Ensemble Norm 0.875 - - -
MFE -32.940 -42.504 -36.448 -63.297
Ligands - cobalamin cobalamin cobalamin
Gene RAP1A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 19.002 2.006
Length SE - 4. 0. 4.
Lev Distance - 41. 41. 43.
UBS 9. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 1. 1. 3. 1.
H 3. 2. 3. 3.
BL 4. 3. 2. 3.
BR 3. 4. 0. 3.
UN 0.217 0.214 0.175 0.138

Sequences

Field Description
UTR seq + 25 ggauagauucccagaagugggauaacuggaucagagggugauuacccuguguauaagaguaugugucucacugcaccuucaauggcauugaaucgucaguauuuaaacagaucacaucATGCGTGAGTACAAGCTAGTGGTCC
UTR dot + 25 ……..(((((….)))))………((.(((((….))))).))……(((.((((.(((((.(((…………(((((((….).))))))………….)))))))))))).)))……..
RS 1 seq UCAUGCUUAAAUAUUGUCGGUUCUGAUGGGGACCAGCCAUCAGACGUAAGGGGGAAAGUCCGGCGUAAAUCCGGCGCUGUCCCGCAGCUGUGAGGAGAGACACAACUCUCGAAGUCAGAAUGCCCGCCGAACUGUCUCCUCUGGA
RS 1 dot …………………((((((((…….))))))))…..((((((.(((.(((((…….((((((.((((((….))).))).))…………………))))))))).))).))))))…..
RS 2 seq ACUACAUACAUUGAAUCAGGUAAAGCUGAACAAAAAAGCUUUUUAAAAGGGCAAGCUGGUGCAAGUCCAGCGCGGUCCCGCCACUGUAAGUGAAAUAGAUCUAUUUCACAAGCCAGAAAACCUGCCUGAUUUAGAGCACCGGU
RS 2 dot ……………((((……))))……..((((((…))))))..((((((((((((.(((.((((……..(((…((((((((….))))))))….)))…..)))))))))))…))))))))
RS 3 seq UAUGCAGACGACGGGUCCGGUGCCCGUCAACGCCAGCGACGGCGUCAGGGGAGGAAGCCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUGAGCCCGGCAGCAGCCGGGUGAGCCAGGAACUCCCGCCGUCCUCCCUACCGCCCG
RS 3 dot ………(((((((…..))))))).(((((……)))))..((((((((….(((((.((.((((((.(…………….(((((((….)))))))).))).)))..)).)))))))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table