Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088838 Similarity: 0.987 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA088838
Gene: RARB
MFE: -16.481
ENS: 0.881
Length: 87.
Predicted Ligands:
glycine - 8/20
zmp-ztp - 4/20
cyclic-di-GMP - 3/20
 RS: URS0000C7A4AE_1423796
MFE: -17.231
Ligand: glycine
Species: Lactobacillus rennini DSM 20253 Glycine riboswitch
 RS: URS0000D88D99_1538463
MFE: -33.245
Ligand: fluoride
Species: Nocardia donostiensis Fluoride riboswitch
 RS: URS0000ABA0FA_40041
MFE: -18.331
Ligand: glycine
Species: Streptococcus equi subsp. zooepidemicus Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088838 URS0000C7A4AE_1423796 URS0000D88D99_1538463 URS0000ABA0FA_40041
Length 87. 87. 87. 87.
Similarity - 0.987 0.985 0.984
Ensemble Norm 0.881 - - -
MFE -16.481 -17.231 -33.245 -18.331
Ligands - glycine fluoride glycine
Gene RARB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 1.001 3.001
Length SE - 0. 0. 0.
Lev Distance - 16. 20. 20.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 4.
ILR 3. 3. 3. 2.
H 1. 1. 1. 1.
BL 2. 1. 2. 1.
BR 2. 1. 2. 2.
UN 0.138 0.184 0.103 0.161

Sequences

Field Description
UTR seq + 25 uugacagagcuugaagcaaaugaaaaucaagucucaauuuauucagcaaauaauuaugaggaATGATTTACACTTGTCACCGAGATA
UTR dot + 25 ………((((..((((.((.((((((..(((((..(((((…..)))))…)))))..)))))).)).))))…))))…
RS 1 seq UGACAAAACUCUGGAGAGCAGUAAGCACCGAAGGAGCAACUCUUAUUUAAGGGGAAUCUCUCAGGUUAGUGUGACAGAGGAUACUGU
RS 1 dot ……..(((((….(((.((…(((…((((…(((((…..)))))…))))..))))).)))..)))))……..
RS 2 seq CUUGUCGUCGGCGAUGGAUCUCCGCCAAGGCACCCCAGGUGGUGUCUGAACCGCCUCGCUGCCGGGGCUGAUGGUUCCUUUCUCGUC
RS 2 dot ………(((((.(((((((.(((..((((….(((((((……)))))))…))))..))).)).)))))…..)))))
RS 3 seq GGACGGGCUUCUGGAGAGACCUAUUAGGCGCCGAAGGGGCAAGGCAAAACUGCUCAAUCUCUCAGGCAAAAGGACAGAAGAUAAAAU
RS 3 dot …….((((((……(((.((….(((..(((((…((((….))))…)))))..))))).))).))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table