Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088847 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA088847
Gene: RARRES1
MFE: -35.124
ENS: 0.888
Length: 96.
Predicted Ligands:
SAM - 7/20
TPP - 5/20
purine - 3/20
 RS: URS0000C41F34_1333662
MFE: -21.049
Ligand: SAM
Species: Polaribacter atrinae SAM-I/IV variant riboswitch
 RS: URS0000C25FFB_943816
MFE: -33.670
Ligand: cobalamin
Species: Streptomyces sp. 172205 Cobalamin riboswitch
 RS: URS0000ABA2D0_525254
MFE: -15.963
Ligand: TPP
Species: Anaerococcus lactolyticus ATCC 51172 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088847 URS0000C41F34_1333662 URS0000C25FFB_943816 URS0000ABA2D0_525254
Length 96. 95. 96. 96.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.888 - - -
MFE -35.124 -21.049 -33.670 -15.963
Ligands - SAM cobalamin TPP
Gene RARRES1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 2. 5.
Length SE - 1. 0. 0.
Lev Distance - 23. 26. 26.
UBS 7. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 2. 2. 2. 2.
BR 0. 1. 1. 2.
UN 0.083 0.147 0.094 0.062

Sequences

Field Description
UTR seq + 25 uuuccgcgagcgccggcacugcccgcuccgagcccgugucugucgggugccgagccaacuuuccugcguccATGCAGCCCCGCCGGCAACGGCTGC
UTR dot + 25 ….((.(((((..(((…)))))))))).(((((…….)))))((((.(((…….((((……))))…….)))..))))…
RS 1 seq GUAAUGUAUCAGGAACGCAAAAAAUGCGUACCAACCGAGCACAACAGCCACGGUGGUUUAGAAUACGGACAGUUCAGUCAAAAUAAAUGAACCUC
RS 1 dot ………..((.(((((…..))))).)).((((.((……))..))))((((((…….(((……)))……..))))))..
RS 2 seq GGGAAGCCGGUGCGAAUCCGGCGCUGACCCGCAACCGUGAGCGGUCCGCCACGCCGUCGCGUACGUCCGACACAGAUCGCCUCCCGCGAUCCGGCC
RS 2 dot …..(((((…….)))))((.((.((((……..)))))).))…(((((((((……(((……)))…..)))))..)))).
RS 3 seq GAUAUUAGCUAGGGGUGCUUUUAGCUGAGAGAUGAUUCAUCAACCCUUUAAACUUGUUAGGUUAGAACCUGCGUAAGAAAGCUAGAAAGAAGAGUU
RS 3 dot ….((((((((((….))))))))))..((((…))))(((.((((…((.(((((((….)))))………)).))…)))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table