Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA088940 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA088940
Gene: RASGRF1
MFE: -10.050
ENS: 0.893
Length: 60.
Predicted Ligands:
fluoride - 18/20
unknown - 2/20

 RS: URS0000BE173B_413999
MFE: -10.859
Ligand: fluoride
Species: Clostridium botulinum A str. ATCC 3502 Fluoride riboswitch
 RS: URS0000C54887_1094508
MFE: -12.809
Ligand: fluoride
Species: Thermoanaerobacterium saccharolyticum JW/SL-YS485 Fluoride riboswitch
 RS: URS0000C025A4_929704
MFE: -9.159
Ligand: fluoride
Species: Myroides odoratus DSM 2801 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA088940 URS0000BE173B_413999 URS0000C54887_1094508 URS0000C025A4_929704
Length 60. 60. 61. 61.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.893 - - -
MFE -10.050 -10.859 -12.809 -9.159
Ligands - fluoride fluoride fluoride
Gene RASGRF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 9.002 10.002
Length SE - 0. 1. 1.
Lev Distance - 11. 11. 11.
UBS 5. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 1. 1. 1. 2.
H 1. 1. 1. 1.
BL 3. 2. 1. 1.
BR 1. 1. 1. 0.
UN 0.433 0. 0.393 0.393

Sequences

Field Description
UTR seq + 25 cugauuaucacaaacaaggaaucugugccuagcugATGCAGAAGGGGATCCGGCTGAATG
UTR dot + 25 ……………..(((.(((.(..((.((….))))..).))))))………
RS 1 seq AGAAUUUUGGGCGAUGGAGUUCGGCAUUAAAUGCGUGAAGCUAAUGACUCCUACAAAUAG
RS 1 dot ……………((((((.(((.(((……))).)))…))))))………
RS 2 seq AUUAAGAUUGGUGAUGGAGCUCACCAUUAAAUGCGAUGAUGCUGAUGGCUCCUAUUGGGUA
RS 2 dot ……………((((((((.(((((…….))))).)))..)))))………
RS 3 seq AUCAUAAUAGGCAAUGAUGUCUGCCUCGAACCGCCUUGUAGCUGAUGACGUCUAGUAUACU
RS 3 dot ……………((((((.((..(((……)))..))….))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table