Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089149 Similarity: 0.981 Similarity: 0.981 Similarity: 0.978
UTR: 5HSAA089149
Gene: RBBP5
MFE: -19.134
ENS: 0.910
Length: 110.
Predicted Ligands:
TPP - 16/20
SAM - 3/20
molybdenum - 1/20
 RS: URS0000C8A279_1218173
MFE: -21.933
Ligand: TPP
Species: Bacillus alcalophilus ATCC 27647 = CGMCC 1.3604 TPP riboswitch (THI element)
 RS: URS0000D87352_1780378
MFE: -29.
Ligand: TPP
Species: Clostridiales bacterium CHKCI001 TPP riboswitch (THI element)
 RS: URS0000AB8FD1_693746
MFE: -37.008
Ligand: TPP
Species: Oscillibacter valericigenes Sjm18-20 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089149 URS0000C8A279_1218173 URS0000D87352_1780378 URS0000AB8FD1_693746
Length 110. 110. 110. 111.
Similarity - 0.981 0.981 0.978
Ensemble Norm 0.910 - - -
MFE -19.134 -21.933 -29. -37.008
Ligands - TPP TPP TPP
Gene RBBP5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 1.010 3.003
Length SE - 0. 0. 1.
Lev Distance - 24. 26. 27.
UBS 6. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 1. 0. 0.
H 4. 4. 3. 5.
BL 2. 1. 2. 1.
BR 1. 0. 1. 1.
UN 0. 0.282 0. 0.243

Sequences

Field Description
UTR seq + 25 auaaccauaauaaauccauuacauguuuaugugaguaguuauuuuguuuucaaaaacaaaguauuuagugaggaaaaugccacugATGAACCTCGAGTTGCTGGAGTCCT
UTR dot + 25 ………………((((((….))))))…..((((((((((….)))))))))).((((((.(…….)))))))…..(((.((…)).)))….
RS 1 seq CGAGAAAACUAGGGGUGCUUAUCUUGAAUAAGCUGAGAAAAAGGUGGUUCCUUUUACCCUUUUAACCUGAUCUGGAUCAUACCAGCGUAGGGAAGUUGAUGCUUGUUAUG
RS 1 dot …………….((((((…..))))))……(((((.(((…….))))))))..((((..((((……))))..)))).((((….))))……
RS 2 seq AAUAAAGUGCUGGGGAGCUAGCCGUAAGCUGGCUGAGAGGGAGUUGGAGGACUCCGACCCAUAACCUGAUGCGGAUAAUACCGACGUAGGAAGACAACGUAUAUGAGUAG
RS 2 dot ……………(((((((…..)))))))…..((.((((((….))))))))….(((.((((((……))).))))))………………..
RS 3 seq UUACACAUAAAGGGGAGUCCGCUGCUUCGCGGGCUGAGAGGGAGUCGAAAGGCUCCGACCCAUGACCUGAUUUGGAUCAUGCCAACGUAGGGAAAUACCGCGUGCUUUUGC
RS 3 dot ……………(((((((……)))))))…..((((((….))))))….(((((((……)).)))))…((((.((……))))))((….))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table