Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089262 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA089262
Gene: RBM14
MFE: -37.682
ENS: 0.921
Length: 116.
Predicted Ligands:
TPP - 7/20
glycine - 4/20
methionine - 3/20
 RS: URS0000C35420_1574623
MFE: -32.081
Ligand: guanidine
Species: Lyngbya confervoides BDU141951 Guanidine-I riboswitch
 RS: URS0000DB4792_1798282
MFE: -30.520
Ligand: TPP
Species: Gammaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_41_15 TPP riboswitch (THI element)
 RS: URS0000AB20FE_378753
MFE: -39.041
Ligand: methionine
Species: Kocuria rhizophila DC2201 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089262 URS0000C35420_1574623 URS0000DB4792_1798282 URS0000AB20FE_378753
Length 116. 115. 115. 115.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.921 - - -
MFE -37.682 -32.081 -30.520 -39.041
Ligands - guanidine TPP methionine
Gene RBM14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4.002 16.001
Length SE - 1. 1. 1.
Lev Distance - 31. 32. 29.
UBS 7. 7. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 2. 3. 3. 1.
H 2. 1. 3. 3.
BL 2. 2. 2. 3.
BR 2. 3. 2. 4.
UN 0.086 0.078 0.130 0.113

Sequences

Field Description
UTR seq + 25 auuccugaggaggacugccggucguucggacgucuugccugucgcuggaggagagguccgggcucuccaggaagguggcugcggcgacaaaATGAAGATATTCGTGGGCAACGTCG
UTR dot + 25 ……..(((.((((…)))).))).(((((..((((((((((((.(((((((…….))))))………..).))))))))……………..))))))))).
RS 1 seq GAACUUAGCGUCUAGGGUUCCGGCUUGGUUGAUUUAACAAGUGUCUGGUCCGAGAGAUGCAGUUAGGCUUUUGUUAAUCAAGCCUAAUUCACGGAGGGAUAAAAGCCCGGGAGGA
RS 1 dot ……..(.(((.((((((((((((((((((((((((..((((((……..)))))).)))))……))))))))))))…………)))…..)))).))).).
RS 2 seq UACAAACACUAGGGGUGUCAGGUAUAACCUGACUGAGAAAACAGAUAAUUAUUCUGUUUAACCCUCUGAACCUGAUCGGGUUAGGACCUGCGAAGGGAAGUGAGAAUCGCUUAUU
RS 2 dot …..(((((…)))))(((((.((((((((((.((((((((((…….)))))))…..))).)….).))))))))..)))))…….((((((…))))))…
RS 3 seq GAUGACGAGUUCCGGCGCGUAGCUCUGGCUGGCCGGACGGCAACCCUCUCCCGUAGCGGGGUGCCCCAGAUGACCAUCCGGCCGCGGUUCGAACCGAUCACGGCAAGUGCGGUUU
RS 3 dot ……(((((.((…)).)))))..((.(((((((.(((((((((((…..)).)))))……..)).)).)))))))))…..((((((..(((…..)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table