Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089285 Similarity: 0.969 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA089285
Gene: RBM18
MFE: -45.668
ENS: 0.921
Length: 138.
Predicted Ligands:
SAM - 13/20
cobalamin - 4/20
FMN - 1/20
 RS: URS0000D99008_147047
MFE: -49.451
Ligand: cobalamin
Species: Desulfovibrio mexicanus Cobalamin riboswitch
 RS: URS0000C2D40E_1736486
MFE: -64.950
Ligand: SAM
Species: Kitasatospora sp. Root187 SAM riboswitch (S box leader)
 RS: URS0000B1EB11_56956
MFE: -64.393
Ligand: SAM
Species: Thermus brockianus SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089285 URS0000D99008_147047 URS0000C2D40E_1736486 URS0000B1EB11_56956
Length 138. 138. 138. 137.
Similarity - 0.969 0.967 0.967
Ensemble Norm 0.921 - - -
MFE -45.668 -49.451 -64.950 -64.393
Ligands - cobalamin SAM SAM
Gene RBM18 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 3. 8.003
Length SE - 0. 0. 1.
Lev Distance - 40. 43. 40.
UBS 10. 9. 10. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 1.
ILR 2. 3. 3. 2.
H 3. 3. 3. 4.
BL 3. 3. 3. 4.
BR 3. 2. 2. 4.
UN 0.152 0.145 0.152 0.095

Sequences

Field Description
UTR seq + 25 gcggcauugaggcggacgcgucuagagguccgucugaccgcggcgucgggaccugguuuccgggcaugagcugagagcaccacgccgaggccacgaguauuucauagacauugATGGAAGCAGAAACCAAAACTCTTC
UTR dot + 25 ((((…(.((((((((……….)))))))).)))))(((.((((….(((((((..(((….)))..))).))))..)))).)))….((.((((((……..))))))))……………..
RS 1 seq GGAAGACGGUGCAAAUCCGUCGCAGACGCGCUGCUGUGACCGGGAAACAUGCCGGCUGUGCCCACUGGGUCCAAGGACCUGGGAAGGAUGCGGCCACCACGGCAGGGGGAACGUGCCCCCGCCCGGAAGCCAGAAGAC
RS 1 dot …….(((…..((((((((((……..)))))))..)))…..)))(((((((.((.((((((……))))))…)).))))))).((..(((.(((((……)))))))).))…………
RS 2 seq AGCUCAUCCAGAGGGACUGAGGGAACGGCCCGUCGAAGUCCCGGCAACCUUCUCGUACGGCCGACCAGCAGUGGUCUUCCGGCGGGACAGGUGCCAAUUCCGUCCUGUGGCGCGCCCGCGUCACGGGGAAGAUGAGGA
RS 2 dot …………((((((((.((……)).))..))))))(((.((((((((((.(((..(((((….)))))..))))))))).)))))))…((..(((((((((((….)))))))))))..))……
RS 3 seq CUCUUAUCCAGAGCGGUGGAGGGUACGGCCCUGUGAAGCCGCGGCAACCUCCUGCCCCUUCCGUUCCAUAGCCGGAAACGGGCGGGGUUGGUGCCAACGCCGGCCCGGGCGGGGGAAACGCCCGGGGACGAUAAGAG
RS 3 dot ((((…..))))(((((.(((((…))))).)…)))).((((….((.(((((.((((((((……)))).)))).))))).))))))…..((.((((((((…….))))))))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table