Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089293 Similarity: 0.974 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA089293
Gene: RBM19
MFE: -32.169
ENS: 0.926
Length: 109.
Predicted Ligands:
glycine - 10/20
guanidine - 4/20
TPP - 3/20
 RS: URS0000D80E85_1660349
MFE: -49.838
Ligand: glycine
Species: Kocuria sp. SM24M-10 Glycine riboswitch
 RS: URS0000C319BC_1609106
MFE: -37.228
Ligand: glycine
Species: Streptomyces sp. NRRL B-1568 Glycine riboswitch
 RS: URS0000AB530A_452652
MFE: -41.436
Ligand: glycine
Species: Kitasatospora setae KM-6054 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089293 URS0000D80E85_1660349 URS0000C319BC_1609106 URS0000AB530A_452652
Length 109. 108. 109. 107.
Similarity - 0.974 0.974 0.974
Ensemble Norm 0.926 - - -
MFE -32.169 -49.838 -37.228 -41.436
Ligands - glycine glycine glycine
Gene RBM19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 3.001 5.
Length SE - 1. 0. 4.
Lev Distance - 32. 34. 29.
UBS 6. 5. 7. 5.
BS 3. 2. 2. 2.
ILL 1. 1. 1. 2.
ILR 0. 0. 0. 1.
H 3. 2. 3. 3.
BL 1. 2. 2. 1.
BR 3. 2. 3. 2.
UN 0.156 0.222 0.119 0.140

Sequences

Field Description
UTR seq + 25 ggcggcgcccagggcgguagcgugaaacuugguggaagacgcugaccagucguguuggaaucaaaacagcggggacccugcgccATGTCGCGACTGATCGTGAAGAATC
UTR dot + 25 …(((((..(((((((((((((….(((…..))))))))).))…(.(((((………))))).)).)))))))))…((((((….))))))……
RS 1 seq CCACCCGCAGCGGGAGAGUCCGCCGCCGUCCGCCCCCGGACGGCCGGCGGCGCCGAAGGAGCAAAUCCUCCCCGGGAAUCUCUCAGGCACCCGUACCGCUGCGAGCAG
RS 1 dot …..(((((((((((((.(((((((((((((….)))))))).)))))(.(((..((((……)))).))))…)))))………..))))))))…..
RS 2 seq AGACCCUGUGCGGGAGAGUCCUUCUCAAGGCCCGAAAGGCCUUGGCGAAAGGCGCCGAAGGAGCAAAUCCUCCCCGGAAUCUCUCAGGCACACGUACCGCACGGACGAG
RS 2 dot ……((((((((((((((.(((((((((((…..)))))))).))).))).(((..((((……)))).)))..))))))..)))))(((.((….)))))..
RS 3 seq CGAGCCCGCUCGGGAGAGUCCCGACCCCGCCGAGCAGGUGGGACGCGGGGCGCCGAAGGAGCAACCCCUCCCCGGAAUCUCUCAGGCAUCCGUACCGAACGGGACAG
RS 3 dot …….(((.((((((((((((..((((((…..))))))…)))))).(((..((((……)))).)))..)))))).))).(((((…..)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table