Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089519 Similarity: 0.944 Similarity: 0.943 Similarity: 0.941
UTR: 5HSAA089519
Gene: RBM46
MFE: -64.693
ENS: 0.809
Length: 198.
Predicted Ligands:
cobalamin - 15/20
lysine - 4/20
FMN - 1/20
RS: URS000232ED48_419610
MFE: -81.051
Ligand: cobalamin
Species: Methylobacterium extorquens PA1 Cobalamin riboswitch
RS: URS000232E3D3_1528693
MFE: -82.845
Ligand: cobalamin
Species: Burkholderia sp. AD24 Cobalamin riboswitch
RS: URS0002319BC3_1505936
MFE: -77.912
Ligand: cobalamin
Species: Mesorhizobium sp. ORS3428 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089519 URS000232ED48_419610 URS000232E3D3_1528693 URS0002319BC3_1505936
Length 198. 200. 198. 197.
Similarity - 0.944 0.943 0.941
Ensemble Norm 0.809 - - -
MFE -64.693 -81.051 -82.845 -77.912
Ligands - cobalamin cobalamin cobalamin
Gene RBM46 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 4.001 10.003
Length SE - 4. 0. 1.
Lev Distance - 63. 74. 72.
UBS 16. 16. 16. 16.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 3.
ILR 6. 5. 6. 4.
H 4. 5. 5. 5.
BL 6. 4. 5. 4.
BR 3. 5. 2. 3.
UN 0.076 0.050 0.040 0.132

Sequences

Field Description
UTR seq + 25 aaacgaguggagacacgaggaccagcgcgagcggucccggugggcuacccucccccugcgacgacccccccucgcucugaccgacugguccccuaaacgguggcggcgguuuuuggucguugggccccgggauuuaggaccaacauuugaagacccgaaggggaacugcaaccATGAATGAAGAAAATATAGATGGAA
UTR dot + 25 ….(((.((((.(((..(((((.((….)))))))..)))..)).))))).(((…(((((((…..(((((.(.((((..(((….)))..)))).).)))))…..))))))))))(((((((.((((((…….))))))..)))…))))……..((((……………..))))..
RS 1 seq CGUAGCUUGACCGUUGACGGUUCCCGCAAGGGAUCAAAAGGGAACGCGGUGGAGGGCUUUCGAGCUCGAUCCCGCGGCUGCCCCCGCAACUGUGAGCGGAGAGUCCUCCAUCACCACGUCACUGGGCAUGCCUCGCCUGGGAAGACGAUGGAGGGCGACGACCCGCCAGCCAGGAGACCUGCCGUCAGCCGUGGUCACAC
RS 1 dot (((..(((((((.(((.(((…)))))).)).)))…))..))).((((((((((((((..(((((…..((((……))))…..))))).)))))))))))))).(((((((.((((((…….))))))…)))).)))..((((……)))).((((((.(((…..)))..)).))))…..
RS 2 seq UUACGCUUGCGCCCUGAUGGUUCCCCUGACCGGGAUCAAAAGGGAACGCAGUGAGGCGCAGCAAUGCGCCGAGUCUGCGGCUGCCCCCGCAACUGUAAGCGACGAGUUCGCGCCACUCAUGACCACUGGGACACCGGGAAGGUCGGCGCAGAAUGACGACUCGCGAGCCAGGAGACCUGCCAUCGACCGAGGUCUGCG
RS 2 dot …(((.((((((((..(((((((…….)))))))..))))..))))))).((((((….)))))).(((.(((((……))))))))((..((((((.(((((((((……((((.((((….))))…))))))))).))))..))..))))..))..(.((((((………..)))))).).
RS 3 seq AUAGUCGCCUGCGUCGUCGGUUCCGUUUUUGGAGCCAAGAGGGAAUGCGGUGAGGGCGACUUCCUGCCCAAAGCCGUGGCUGCCCCCGCAACUGUGUGCGGUAGUCCUCCCCAUAGACCACUGAGGGUUUCCCUCGGGAAGGUGGGGAAGGGCGCGAAUCCGCGAGCCAGGAGACCUGCCGGCGACAGAAAAGAUGA
RS 3 dot ….(((((.(((((.(((((((((….)))))))..)).)..)))))))))(((((…….((((……).))))))))(((((……)))))..(((((((((((….(.(((((((…))))))))…))))))).))))…….(((..(.((((…)))))..)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table