Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089522 Similarity: 0.960 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA089522
Gene: RBM46_0
MFE: -54.597
ENS: 0.994
Length: 152.
Predicted Ligands:
FMN - 12/20
glycine - 3/20
guanidine - 2/20
 RS: URS0000D96F58_1883416
MFE: -58.835
Ligand: guanidine
Species: Halomonas sp. 1513 Guanidine-I riboswitch
 RS: URS0000C608EE_179408
MFE: -38.503
Ligand: guanidine
Species: Oscillatoria sp. PCC 7112 Guanidine-I riboswitch
 RS: URS0000AB877D_913865
MFE: -43.215
Ligand: FMN
Species: Desulfosporosinus sp. OT FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089522 URS0000D96F58_1883416 URS0000C608EE_179408 URS0000AB877D_913865
Length 152. 153. 152. 151.
Similarity - 0.960 0.960 0.960
Ensemble Norm 0.994 - - -
MFE -54.597 -58.835 -38.503 -43.215
Ligands - guanidine guanidine FMN
Gene RBM46 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 11.001 9.
Length SE - 1. 0. 1.
Lev Distance - 49. 49. 49.
UBS 11. 11. 9. 11.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 2.
ILR 3. 5. 4. 3.
H 4. 3. 3. 4.
BL 2. 3. 3. 4.
BR 1. 1. 1. 2.
UN 0.099 0.118 0.132 0.113

Sequences

Field Description
UTR seq + 25 acacgcuuacgccgacgaccaacgaccgcugcaggcccgggccgcugccuggccguuguaggguccgcgcguccccuggaggcuuuggacgccgucuggggcgucccgacggcugggaacugcaaccATGAATGAAGAAAATATAGATGGAA
UTR dot + 25 ….((….)).((((..(…((((.(((((((.((((((….))))))))..))))))))).)..))))(((….((((..(((((((……)))))))….)))))))……..((((……………..))))..
RS 1 seq CCAAUGGACGGCUAGGGUUCCGAUCGCAUCAUCACUCACCCCGAUGCGAUGACUGGUCCGAGAGCCGUCGACCCGGCGCAACAGAGGAGAUGCCCGCAGGGGCACUUUAUCUCGAGGCGCAAGGUUACACGGCGGGAGAAAAGCCCGGGAGGA
RS 1 dot ……(((((((.(((..(((((((((((…………))))))))…))))))…)))))))((((..((((..((((.(((.(((((….))))))))..))).)..))))..))))……((((…….))))……
RS 2 seq UUUAACCGCUUCUAGGGUUCCGAUUUGAAUCAGUUUCUAACUCAGGUUAGACAGUUCAAGUGCUGGUCCGAGAGAAGCAGACUGGUUCUCCCAAGAUUUUAAAUUUAGGGAAACACUAGCCAGUUACACGGCGGGAUAAAAGCCCGGGAGAA
RS 2 dot …….((((((.(((..(((((((((((…..(((((……)))))..))))))))..))))))…)))))).((((((((.((((.(((((…))))).))))……))))))))……((((…….))))……
RS 3 seq AUGAACCUUCGGGGCAGGGUGAGAUUCCCUACCGGCGGUGACGAUUGCCCGUGCAAUUCAGCCCGCGACUCGACGUAACCAUUAUUGUUGCGCCGAUUGACUUGGUGAAAUUCCAAGGCCGACGGUAUAGUCCGGAUGAGAGAAGGAACAA
RS 3 dot ……..(((((((.((((..((((…(((.((((((….)))))).))).))))..))))))..)))))((((((…….))))))(((.(((.(((((…….)))))..))))))…..(((………..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table