Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089544 Similarity: 0.953 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA089544
Gene: RBM5
MFE: -59.264
ENS: 0.849
Length: 182.
Predicted Ligands:
cobalamin - 9/20
lysine - 7/20
Ni/Co - 3/20
 RS: URS0002319286_484770
MFE: -49.652
Ligand: cobalamin
Species: Pelosinus sp. UFO1 Cobalamin riboswitch
 RS: URS0002311C13_212717
MFE: -34.167
Ligand: cobalamin
Species: Clostridium tetani E88 Cobalamin riboswitch
 RS: URS00002D993A_1231072
MFE: -34.167
Ligand: cobalamin
Species: Clostridium tetani 12124569 Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089544 URS0002319286_484770 URS0002311C13_212717 URS00002D993A_1231072
Length 182. 183. 182. 183.
Similarity - 0.953 0.952 0.952
Ensemble Norm 0.849 - - -
MFE -59.264 -49.652 -34.167 -34.167
Ligands - cobalamin cobalamin cobalamin
Gene RBM5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.002 10.001 10.001
Length SE - 1. 0. 1.
Lev Distance - 56. 60. 59.
UBS 9. 12. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 3. 5. 4. 4.
H 3. 3. 3. 3.
BL 2. 1. 4. 4.
BR 3. 3. 2. 2.
UN 0.192 0.148 0.154 0.158

Sequences

Field Description
UTR seq + 25 auuuuguguagccgccgaaccuuguuggagguucuggggcgcagaaccgcuacugcugcuucggucucuccuugggguaagugcggcggcugucuguaacgacgaaaaaauaaaauuugaaccuuuuggagcugugugcuaaaucuucagugggacaATGGGTTCAGACAAAAGAGTGAGTA
UTR dot + 25 ………((((((((.((((((..(((((..(((((((((((……..)))).)))))))..))))).))))))…..))))))))(((……)))…………(((((((((.(((..((((………….))))….))).)))))))))…………..
RS 1 seq UUUCAUAUGAAUGGUAUAGGUGCCCUUCGGGGCUUAAUAGGGAAGUUCGGUUCAAAGCCGGCGCGGUCCCGCCACUGUAAUGAGGAGUGAACCCAUGGUUAUGCCACUGAGACGACAGUCUUGGGAAGGUAUGGGCAAGCAAUGAUUCAGAGUCAGGAGAACUGCCUAUAUAGCAAUCACCGU
RS 1 dot ………..((((((((((((((((((((((……((((.((((((((…)))))).))..))))))).)))….)))).))..)))……)))))))(((((((….)))))))….(((((((((…..(((((…)))))…….)))))))))…………
RS 2 seq UUUAAUAUUAUUUUAUUAGGUGCUUUACAAGUUAAAAGGGAAAGUGGUGAAAAUCCACUGCAGCCCACCGUUACUGUAAUGCUGACGAAAUCUUAUAAAAUCCACUAGAUAUAUUUUAUCUGGGAAGGUUAGAAAUUAGGAAGAAGCUAAGCCAGGAAACCUGCCUAAUAAGUGUUAAUUCU
RS 2 dot ………(((((((.((((((.((((.(((…..(((…((((((……))))))..)))……))))))).))…….)))).)))))))((.(((((((…..)))))))…))……((((((…………((((…))))))))))………….
RS 3 seq UUUAAUAUUAUUUUAUUAGGUGCUUUACAAGUUAAAAGGGAAAGUGGUGAAAAUCCACUGCAGCCCACCGUUACUGUAAUGCUGACGAAAUCUUAUAAAAUCCACUAGAUAUAUUUUAUCUGGGAAGGUUAGAAAUUAGGAAGAAGCUAAGCCAGGAAACCUGCCUAAUAAGUGUUAAUUCUU
RS 3 dot ………(((((((.((((((.((((.(((…..(((…((((((……))))))..)))……))))))).))…….)))).)))))))((.(((((((…..)))))))…))……((((((…………((((…))))))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table