Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089623 Similarity: 0.989 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA089623
Gene: RBM8A
MFE: -14.582
ENS: 0.975
Length: 54.
Predicted Ligands:
glutamine - 13/20
unknown - 6/20
homocysteine - 1/20
 RS: URS0000C0A753_12908
MFE: -9.916
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E5FC7F_1921510
MFE: -25.831
Ligand: unknown
Species: Sphingomonas sp. JJ-A5 sul1 RNA
 RS: URS0000D6A087_317655
MFE: -25.831
Ligand: unknown
Species: Sphingopyxis alaskensis RB2256 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089623 URS0000C0A753_12908 URS0000E5FC7F_1921510 URS0000D6A087_317655
Length 54. 54. 53. 53.
Similarity - 0.989 0.989 0.989
Ensemble Norm 0.975 - - -
MFE -14.582 -9.916 -25.831 -25.831
Ligands - glutamine unknown unknown
Gene RBM8A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.005 1.005 1.005
Length SE - 0. 1. 1.
Lev Distance - 14. 14. 14.
UBS 3. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 1. 0. 0.
BR 0. 1. 0. 0.
UN 0.222 0.148 0.151 0.151

Sequences

Field Description
UTR seq + 25 gcacagacgagaucucgaucgaaggcgagATGGCGGACGTGCTAGATCTTCACG
UTR dot + 25 ((((…((..((((((……..))))))..))…))))…………
RS 1 seq AUCGUUCAUCUCGCUUAUUGAGACGGAAGUAAGUUUUAACUGAAGGAACGCAGA
RS 1 dot .((.((((….(((((((……..)))))))……)))).))…….
RS 2 seq ACCGGACCCGGCUUGCCGGGUGGCUCGGCCCGGCGCCUAUCCCCGGGAUAACC
RS 2 dot .((((….(((..(((((((……))))))))))…..))))…….
RS 3 seq ACCGGACCCGGCUCGCCGGGUGGCUCGGCCCGGCGCCUAUCCCCGGGACAACC
RS 3 dot .((((….(((..(((((((……))))))))))…..))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table