Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089624-0 Similarity: 0.968 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA089624-0
Gene: RBM8A_0
MFE: -37.902
ENS: 0.522
Length: 135.
Predicted Ligands:
cobalamin - 10/20
FMN - 5/20
glycine - 2/20
 RS: URS000231E17C_1214101
MFE: -45.611
Ligand: cobalamin
Species: Streptomyces davawensis JCM 4913 Cobalamin riboswitch
 RS: URS000232587A_1703937
MFE: -42.215
Ligand: cobalamin
Species: Streptomyces sp. CB03234 Cobalamin riboswitch
 RS: URS000231E8B4_1223542
MFE: -53.690
Ligand: cobalamin
Species: Gordonia malaquae NBRC 108250 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089624-0 URS000231E17C_1214101 URS000232587A_1703937 URS000231E8B4_1223542
Length 135. 136. 136. 136.
Similarity - 0.968 0.968 0.967
Ensemble Norm 0.522 - - -
MFE -37.902 -45.611 -42.215 -53.690
Ligands - cobalamin cobalamin cobalamin
Gene RBM8A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.003 3. 3.001
Length SE - 1. 1. 1.
Lev Distance - 41. 41. 42.
UBS 11. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 4. 4. 5. 4.
H 2. 2. 2. 3.
BL 3. 3. 3. 4.
BR 4. 3. 3. 3.
UN 0.096 0.044 0.103 0.066

Sequences

Field Description
UTR seq + 25 agaguuagccuuugauuggucagcuugacuggcgaccuuuccccucugcgacaguuucccgagguaccuagugucugagcggcacagacgagaucucgaucgaaggcgagATGGCGGACGTGCTAGATCTTCACG
UTR dot + 25 …….((((((((((((….((((.((((((((((….((((.(.((…..))).))))…..)).)))……)).))).))))…))))))))))))((..(((((….)))))..))……
RS 1 seq AAGAUGUAUGCUCAUGCUCGCUGUCGUCGCAGGGGAAUCCGGUGUGAAUCCGGAACUGUCCCGCAACGGUGUACUUAUGCGUGUUCCGGCAUGUAUGAGCGUCAGUCCGAGGACCUGCCGACAGUGUGCCCGGCCG
RS 1 dot ..(((..((((((((((..((((((((.((.((((..(((((…….)))))….)))))).))))……………..))))..))))))))))..)))((.(((((((….))).)).))))….
RS 2 seq GCCCCCCACAUGUAUGCUCGUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGCAAAUCCGGAACUGUCCCGCAACGGUGUGUUGGUGUGCCUUUGUGUACGUACGAGUCCGAAGACCUGCCGACAGCGCGCCCGGACC
RS 2 dot ………((((((((….((.(((((.(((((..(((((.(((((…….)))))….)))).)..)))))…))))).))….))))))))….(((((….((((….))).)….))))).
RS 3 seq UGUCGCCGGGCUGGCUACGAUUGGCGGCGAACUCGAUGUGGAAGCCGGUGUGAAACCGGCGCGGUCGCGCCACUGUGAGGAUCCGGUGUUCAUUGGCCGGUCCGAGCCAGACCCACGUCGUCAGGCCGAGAAGCCU
RS 3 dot ….(((((((((((((.((.((.(((.(..((((..((((..((((((…..))))))………))))..))))..)))).)).))..))))))))))).))..(((….)))…((((……))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table