Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089624-1 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA089624-1
Gene: RBM8A_1
MFE: -44.876
ENS: 0.962
Length: 135.
Predicted Ligands:
cobalamin - 7/20
molybdenum - 6/20
TPP - 5/20
 RS: URS0002312325_1076596
MFE: -42.533
Ligand: cobalamin
Species: Acetobacter persici Cobalamin riboswitch
 RS: URS0000D9C937_1797881
MFE: -35.942
Ligand: molybdenum
Species: Deltaproteobacteria bacterium RIFCSPLOWO2_02_FULL_50_16 Moco (molybdenum cofactor) riboswitch
 RS: URS0000DABA43_1805133
MFE: -45.221
Ligand: cobalamin
Species: Elusimicrobia bacterium CG1_02_63_36 AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089624-1 URS0002312325_1076596 URS0000D9C937_1797881 URS0000DABA43_1805133
Length 135. 135. 134. 134.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.962 - - -
MFE -44.876 -42.533 -35.942 -45.221
Ligands - cobalamin molybdenum cobalamin
Gene RBM8A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 5. 5.001
Length SE - 0. 1. 1.
Lev Distance - 39. 38. 38.
UBS 9. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 3. 3. 2. 4.
H 3. 3. 3. 2.
BL 3. 2. 4. 2.
BR 3. 3. 4. 2.
UN 0.141 0.111 0.157 0.172

Sequences

Field Description
UTR seq + 25 uuucccgagguaccuagugucugagcggcacagacgagaucucgaucgaaggcgagauggcggacgugcuagaucuucacgaggcugggggcgaagauuucgccauggauATGGCGGACGTGCTAGATCTTCACG
UTR dot + 25 …………((((((.((((((.(((((…((..((((((……..))))))..))…)))))…..)))).)).))))))((((((…))))))..((((.(((((….))))).))))…..
RS 1 seq UAAAUUGACAGGGGCGCAGGGGCCGUUCAGACUAAAGGCUGAUCUGGGGAAGCUGGUGGAAAUCCGGCACGGUCGCGCCACUGUAAUCCGCUUGCUGCAAGCGGGAAGUCAGACCUCCAGCCUUGUUUUUCUGUU
RS 1 dot …….((((.(((((…((((((((.(((((..((((……….))))..)))…)).)).))))))))))).))))..((((((((…))))))))….((((….((….))….))))..
RS 2 seq UUUAAGAUAAAACCUCGAGCGGUCUUCCCUAAGAAAUCACAUGAAGUGAUGAGAUGGGCUGCCGCCUGUGGGUCAAAUUGGAAACGAUUUGGCCUCCCGACCCCGUCUUGGCAAGAGAUCUCAGGAUCCCCUUG
RS 2 dot …………((.((.((((.(..(((……(((((…..)))))…..)))..))))).)).))(((((((((….))))))))).(((.((….(((((…..))))).)).)))……..
RS 3 seq UAAAAGACGUUCAACCCUCCCUUCAGAGGAAUCCGGUGAAAUUCCGGAGCUGCCGCGCAACGGUGAAGUCCCCGCCAAGGGGAAUAAGCCCGGUCGACUGAUGGGAGGAAAUUCCUUCGCGGGAAGGGGAAGAG
RS 3 dot ……………((((((.((((..((..((((….(((((((.(((((((…..))))..))).))……..)))))….))))))..)))).))))))…(((((((….)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table