Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089714 Similarity: 0.960 Similarity: 0.959 Similarity: 0.956
UTR: 5HSAA089714
Gene: RBMX
MFE: -53.942
ENS: 0.729
Length: 148.
Predicted Ligands:
FMN - 8/20
TPP - 5/20
cobalamin - 4/20
 RS: URS0000ABB374_491952
MFE: -43.423
Ligand: FMN
Species: Marinomonas posidonica IVIA-Po-181 FMN riboswitch (RFN element)
 RS: URS0000C65601_1736380
MFE: -59.898
Ligand: FMN
Species: Rhizobium sp. Leaf453 FMN riboswitch (RFN element)
 RS: URS000232AAF3_1198245
MFE: -65.459
Ligand: cobalamin
Species: Micromonospora avicenniae Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089714 URS0000ABB374_491952 URS0000C65601_1736380 URS000232AAF3_1198245
Length 148. 148. 149. 148.
Similarity - 0.960 0.959 0.956
Ensemble Norm 0.729 - - -
MFE -53.942 -43.423 -59.898 -65.459
Ligands - FMN FMN cobalamin
Gene RBMX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.012 15.012 11.007
Length SE - 0. 1. 0.
Lev Distance - 46. 48. 54.
UBS 9. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 1. 4. 3. 2.
ILR 3. 3. 3. 3.
H 3. 4. 4. 4.
BL 4. 4. 3. 3.
BR 2. 2. 2. 4.
UN 0.162 0.054 0.054 0.081

Sequences

Field Description
UTR seq + 25 gugcuagcggcuucgcgguucgguccucgcacccggcagccgccacuggugcugagcugcuaggaagccccuaucgccgagcucguuggagcuugaacccauugucaccccuccguacucuugATGGTTGAAGCAGATCGCCCAGGAA
UTR dot + 25 (((.(((.((((((((((((((……(((((.(((….)))…)))))))))))))…)))))).))).)))(((((((….)))))))…………………..(((((.(((((……)))))..))))).
RS 1 seq UUUCGUUCUCGGGGCGGGGUGAAAUUCCCCACCGGCGGUAAAGAAUUCAUUUCUAAGCCCGCGAGCGCCUAGUCUACUUUGAUUAGGGUCAGCAGAUCUGGUGAGACUCCAGAGCCGACGGUUAUAGUCCGGAUGAUAGAGAGCGCGU
RS 1 dot …(((((.((((..((((((.(((((…(((…)))…)))))))))))….)))).)))))(((((((……)))))))….((…(((((…….)))))))((.((.((…(((…..)))…)).)))).
RS 2 seq GUACGUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAACGGGGAUAUCCCGGAGCCCGCGAGCGCUUCCGGUUAACUGCCGGAAGGUCAGCAGAUCCGGUUGAAUUCCGGAGCCGACGGUUAAAGUCCGGAAGGAAGAGAGCAAGC
RS 2 dot …(((((.(.((((((((((….((((((((…)))…)))))))))))…))))).)))))((((((((…..))))))))(((.((…(((((…….))))))).))).(((….(((….)))….)))….
RS 3 seq CAUCGAUGGGGCCUGGUCUGCUGGUGCGCUACGGUCUUACCGACCGUUCCCAGCGAAGCCGGUGUGACUCCGGUGCUGUCCCGCAACUGUGAUACCCCUCCCCGCGGAGGGGACGAGCCAGGUCGCCUGCGGAUCGGUCGCGACCCGC
RS 3 dot ….(((((.(((.(((((((((((.((((((((((…..))))))….))))..))))))).))))..))).))))).(((….)))…(((((((….)))))))….((..((((((..((……)).)))))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table