Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089726 Similarity: 0.982 Similarity: 0.980 Similarity: 0.978
UTR: 5HSAA089726
Gene: RBMX2
MFE: -26.240
ENS: 0.983
Length: 89.
Predicted Ligands:
SAM - 4/20
glycine - 4/20
GMP - 3/20
 RS: URS0000D69B19_12908
MFE: -24.709
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D8FDE0_1797494
MFE: -30.997
Ligand: homocysteine
Species: Betaproteobacteria bacterium RIFCSPLOWO2_12_61_14 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C2A859_1408226
MFE: -15.677
Ligand: SAM
Species: Vagococcus lutrae LBD1 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089726 URS0000D69B19_12908 URS0000D8FDE0_1797494 URS0000C2A859_1408226
Length 89. 90. 88. 88.
Similarity - 0.982 0.980 0.978
Ensemble Norm 0.983 - - -
MFE -26.240 -24.709 -30.997 -15.677
Ligands - GMP homocysteine SAM
Gene RBMX2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 3. 4.001
Length SE - 1. 1. 1.
Lev Distance - 23. 25. 27.
UBS 5. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 1. 2. 1.
H 3. 3. 3. 2.
BL 0. 1. 0. 0.
BR 1. 1. 0. 0.
UN 0.169 0.256 0.159 0.193

Sequences

Field Description
UTR seq + 25 gcgcaugcgcugcgcugccuuucccgggcgcugauuccugagugcugagcgcgaacccgaggagATGAACCCTTTAACTAAGGTGAAGC
UTR dot + 25 (((((…..)))))….(((((((((((((……………)))))….))).)))))…..((((…..))))……
RS 1 seq UUGCCUUCUGGUAGCAAUGAACCGCAGUUCGAGUCAAGAGCGGUCACCUAGAACUGCGGGGAGCGAGUGGUGAGACCGACCAGAAAAGUG
RS 1 dot (((((….)))))…….(((((((((.((….((….))..)).)))))))))……..((((…….))))……..
RS 2 seq CCCUCCGAGGGGUGCUGCAGCGGGUCUGGACAACCAGUCCCCCGUCAGGCUCGGAGCAGCGAUUUCGUUCCAACGGCACCUGUUCAUU
RS 2 dot ((((….))))((((((..(((((((((((…..))))……)))))))..))))))……….(((((…)))))….
RS 3 seq GAACGUUGCAAGAUUCCCGAUAGGAUUUAAAGAUGUGUAUCUUUGAAGAUUCCUUGUAACCGACUAUUAUUCAGGGGGAAUAUAAAUG
RS 3 dot ….((((((………..(((((((((((((….)))))))))…))))))))))…….(((((…..)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table