Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089727 Similarity: 0.968 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA089727
Gene: RBP1
MFE: -36.329
ENS: 0.873
Length: 136.
Predicted Ligands:
TPP - 8/20
cobalamin - 4/20
FMN - 3/20
 RS: URS0000C394F0_1629719
MFE: -35.848
Ligand: FMN
Species: Clostridiaceae bacterium BRH_c20a FMN riboswitch (RFN element)
 RS: URS0002332B24_936756
MFE: -44.239
Ligand: cobalamin
Species: Streptomyces sp. ZX01 Cobalamin riboswitch
 RS: URS0000C146C5_1235799
MFE: -39.103
Ligand: cobalamin
Species: Lachnospiraceae bacterium 3-2 AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089727 URS0000C394F0_1629719 URS0002332B24_936756 URS0000C146C5_1235799
Length 136. 135. 137. 137.
Similarity - 0.968 0.964 0.963
Ensemble Norm 0.873 - - -
MFE -36.329 -35.848 -44.239 -39.103
Ligands - FMN cobalamin cobalamin
Gene RBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.006 6.006 7.003
Length SE - 1. 1. 1.
Lev Distance - 40. 45. 46.
UBS 10. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 5. 5. 4.
ILR 3. 2. 3. 4.
H 2. 2. 2. 2.
BL 2. 2. 3. 3.
BR 5. 5. 5. 3.
UN 0.176 0.096 0.102 0.124

Sequences

Field Description
UTR seq + 25 aaacgaacugaacgucugaaacgaagguggcgcggccuggacaaaccugacccuucgacaucccccgccccugcgcccgcccucgcuaagcggggaggagcgaccgcuacaATGGATCCTCCCGCAGGCTTTGTGC
UTR dot + 25 …………………(((.((((((((((..(((…….(((….)))…….)))…))))))).))).)))(.((((((((((((….(((……))).))))))).)..)))).)…
RS 1 seq AUUUUUCUUCGGGGCAUGGUGAGAAAGCUAAGGCUUUCAAUUCCUGACCGGCGGUAUAGCCCGCGAGCCAUUUUUUUGGCAUGAACUGGUGUGAUUCCAGUGCCGACAGUAUAGUCUGGAUGGGAGAAGACGGAU
RS 1 dot ………(((..((((.((((((((….(((((…………..((((……))))))))).)))))))).))))..)))((.(..(((((…(((((……))).)).)))))..).))….
RS 2 seq GCCCCCCACAUGUAUGCUCGUCCUCGCUGUCGCAGCAGGGGAAUCCGGUGAGAGUCCGGAACUGUCCCGCAACGGUGUACCGGUGUGCCCUUCGCGUACCCGCGAGUCCGACGACCUGCCGGCAGCGCGCCCGGACC
RS 2 dot ………..(((((((.((…((((((.((….((((..(((((…….)))))….)))))).)))))).)).)))))))((..(((((..(((((.(((….))).))).))..)))))…))…
RS 3 seq UUAAAAACAUAACACAUACAGGCAGCGGGAAUCAGGUGCAAUUCCUGAGCGAUGAGGUCACUGUGUGGGCAAUGCCUAAAGCCAGAUUACCUGCCUGUAUGCAGAAUGGGGCUUCCAUCCAAAGCGAAACAUUCUAC
RS 3 dot …………..(((((((((((.(..((((.((((((…(((..(((.((….)).)))..)))…)))…..))).)))).)))))))))))).((((((..((((…….))))….))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table