Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089750 Similarity: 0.988 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA089750
Gene: RBP7
MFE: -31.478
ENS: 0.996
Length: 87.
Predicted Ligands:
zmp-ztp - 18/20
homocysteine - 2/20

 RS: URS0000C4024C_12908
MFE: -27.345
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
 RS: URS0000C89123_1703384
MFE: -28.505
Ligand: homocysteine
Species: Acidithiobacillales bacterium SM1_46 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C88111_1262989
MFE: -27.975
Ligand: zmp-ztp
Species: Firmicutes bacterium CAG:94 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089750 URS0000C4024C_12908 URS0000C89123_1703384 URS0000C88111_1262989
Length 87. 87. 87. 87.
Similarity - 0.988 0.985 0.985
Ensemble Norm 0.996 - - -
MFE -31.478 -27.345 -28.505 -27.975
Ligands - zmp-ztp homocysteine zmp-ztp
Gene RBP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 1.001 2.001
Length SE - 0. 0. 0.
Lev Distance - 16. 20. 20.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 2. 2. 1. 2.
H 2. 2. 2. 2.
BL 1. 0. 1. 0.
BR 1. 0. 1. 0.
UN 0.103 0.115 0.080 0.080

Sequences

Field Description
UTR seq + 25 gguuuauaggucccggcccgagccuccggccgcccgccggguuugucccgcgauccccgaccATGCCCGCCGACCTCAGCGGTACTT
UTR dot + 25 ((((….((((.(((..(((((..(((((…..))))))))))..))).))))…))))….((((……..))))…..
RS 1 seq AGCUGACCCUUCUGCUGACGGAUCUUGUGGAGCACCACAGUGCAGAAGGGGAGAGAAGCUUUAAUGCCGACCGUCUGGGCAGCCUUG
RS 1 dot ((((..(((((((((..((……(((((….))))))))))))))))..)….)))….((((………))))……
RS 2 seq AUCUCCGAGGAGCGUUGCAACCCUGCCAACAUAUUUGGCGGGCCAGGCUCGGAGGUUCGUGAUAUCCAGCAACGGCGCUCGCUACUA
RS 2 dot ((((((…((((.(((….((((((((…..)))))))).)))))))))))))..((((…((……))…))))…..
RS 3 seq CAAGGCCCCCGCAACUGACGGGCUAAUGUGGAACUCACCACAGGGGAGCGGGGAGCAGCCUUUUUGCCGACCGUCUGGGCAGUGUCG
RS 3 dot .(((((((((((..(…….((..(((((……))))))))..))))))….))))).(((((………)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table