Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089874 Similarity: 0.979 Similarity: 0.977 Similarity: 0.975
UTR: 5HSAA089874
Gene: RCL1
MFE: -38.058
ENS: 0.945
Length: 111.
Predicted Ligands:
TPP - 16/20
guanidine - 4/20

 RS: URS0000ABAF41_435591
MFE: -26.743
Ligand: TPP
Species: Parabacteroides distasonis ATCC 8503 TPP riboswitch (THI element)
 RS: URS0000DAB925_1775951
MFE: -37.935
Ligand: TPP
Species: Agromyces sp. NDB4Y10 TPP riboswitch (THI element)
 RS: URS0000ABAF2B_198628
MFE: -33.683
Ligand: TPP
Species: Dickeya dadantii 3937 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089874 URS0000ABAF41_435591 URS0000DAB925_1775951 URS0000ABAF2B_198628
Length 111. 111. 112. 111.
Similarity - 0.979 0.977 0.975
Ensemble Norm 0.945 - - -
MFE -38.058 -26.743 -37.935 -33.683
Ligands - TPP TPP TPP
Gene RCL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 9.001 1.004
Length SE - 0. 1. 0.
Lev Distance - 25. 27. 34.
UBS 7. 6. 9. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 1. 2. 2.
H 3. 3. 3. 3.
BL 1. 0. 1. 1.
BR 2. 0. 4. 2.
UN 0.180 0.225 0.143 0.117

Sequences

Field Description
UTR seq + 25 gucuacccugagcgggcgccccgucaaaauccgaaagauucgggccagagacgacaacccgggccuccgagagaugggaucucacuATGCCTCCCGGAGGAGGAGGCGAAG
UTR dot + 25 …………((((.((((((((….((((((…))))))…..))))…….)))).)))).(((((…)))))….((((((((….).)))))))…
RS 1 seq CCGAAUACGAAGGGGUGCUCGCAAAAUCCUUCACGAAAGGAGCGGGCUGAGAUCAUACCCAUAGAACCUGUACAGGUAAUGCUGUCGUAGGGAUUCAUGCUUCUCCGAUCC
RS 1 dot …………((((((((((….(((((…..)))))))))))………))))…..((((….))))……((((..((((……..))))))))..
RS 2 seq GGCAGUGACACGGGGUGCCGCCCCACCCGCCGAGCGGGAUGAAGCGGCUGAGAUCACACCCGUCGAACCUGAUCUAGUUCGGACUAGCGAAGGGAUGUCGCCAUGCGCGCAC
RS 2 dot ………((((((((((((..(((((((…))))).))..)))))…….)).)))))(((((……..)))))…..(((…(.(((….))).).)))..
RS 3 seq CCGUUCUCAACGGGGUGCGGCCAACGUUCGUGUACGUUUGCGUCGCUGAGAAAAUACCCGUCGAACCUGAUCCGGUUAAUACCGGCGAAGGGAUUUGAGACUGCAUCCCGC
RS 3 dot ..((((…((((((((..((.(((((……))))).))..)))……….))))).))))…..(((((….)))))….(((((……….)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table