Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA089972 Similarity: 0.971 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA089972
Gene: RDX
MFE: -9.
ENS: 0.999
Length: 116.
Predicted Ligands:
SAM - 8/20
methionine - 7/20
cobalamin - 1/20
 RS: URS0000DA704D_1524462
MFE: -51.352
Ligand: SAM
Species: Rhodanobacter sp. FW510-R10 SAM riboswitch (S box leader)
 RS: URS0000AB8F87_641107
MFE: -23.701
Ligand: SAM
Species: Clostridium sp. DL-VIII SAM riboswitch (S box leader)
 RS: URS0000DA8C76_1803434
MFE: -38.
Ligand: SAM
Species: Acidobacteria bacterium 13_1_20CM_4_56_7 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA089972 URS0000DA704D_1524462 URS0000AB8F87_641107 URS0000DA8C76_1803434
Length 116. 116. 115. 115.
Similarity - 0.971 0.970 0.970
Ensemble Norm 0.999 - - -
MFE -9. -51.352 -23.701 -38.
Ligands - SAM SAM SAM
Gene RDX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.006 11. 20.
Length SE - 0. 1. 1.
Lev Distance - 37. 34. 30.
UBS 9. 10. 9. 12.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 5.
ILR 2. 3. 3. 3.
H 1. 2. 1. 1.
BL 5. 4. 2. 6.
BR 4. 5. 4. 4.
UN 0. 0.078 0.017 0.

Sequences

Field Description
UTR seq + 25 cuuuuaguauuuaauaauugcaaaugauaguguauuauuuuguuuucugcucaccuuaggaacaauacagaucaacguaagaguaacuacaATGCCGAAACCAATCAACGTAAGAG
UTR dot + 25 ((((((((………..(((..((.((((.((((.((.((((.((((………………))))..)))).)).)))))))))).)))…………)).))))))
RS 1 seq CACUCAUCGAGACCGGCUGAGGGACAGGCCCAUUGAAGCCGGGGCAACCUGCGGAGCGCUUCCGCCACGGUGCCAACUCCUGCGGGGAUGCUGCGGCAUCCACCGGAAGAUGGGCG
RS 1 dot ..(((((((….))).))))……(((((((((.((((.((((.(((((((((.((..(((…))).))…)))).)))))..)))).)))).))……..))))))).
RS 2 seq GUCUUAUCAAGAGUGGUGGAGGGACUGGCCCUAUGAAACCCGGCAACCGAAAUAUUGUUUAUCUCAAUAUUUAUAUGGUGCUAAUUCCAGCAGCAGAGUAGCUGAAAGAUGAGAG
RS 2 dot .(((((((…((((.((..((((.(((((((((((……………((((((…….))))))))))).)).)))).))))..)).)……)))….))))))).
RS 3 seq AUUUCAUGCAGAGUGGCUGUGGGACGAGCCCUGAGACGCCACGGCAACCGGACCGGGAUCAUCUAUCGCGGCCGCCAGGUGCCAACUCUCGACCCGGAAACGGGGGACAUGAGAU
RS 3 dot ((((((((…..((..(.((((.((((…((.(.((((..(((….((.(((.(((…..))).)))))))).)))))))…)))).)))).)..))…..))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table