Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090294 Similarity: 0.964 Similarity: 0.963 Similarity: 0.960
UTR: 5HSAA090294
Gene: RFC3
MFE: -48.798
ENS: 0.795
Length: 155.
Predicted Ligands:
FMN - 4/20
Mg2+ - 4/20
cobalamin - 3/20
 RS: URS000231C65E_879308
MFE: -28.313
Ligand: cobalamin
Species: Peptoniphilus sp. oral taxon 375 str. F0436 Cobalamin riboswitch
 RS: URS0000BEAB77_1304275
MFE: -58.459
Ligand: TPP
Species: Salinisphaera hydrothermalis C41B8 TPP riboswitch (THI element)
 RS: URS0000DA904F_255247
MFE: -43.902
Ligand: FMN
Species: Bacillus arsenicus FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090294 URS000231C65E_879308 URS0000BEAB77_1304275 URS0000DA904F_255247
Length 155. 154. 153. 155.
Similarity - 0.964 0.963 0.960
Ensemble Norm 0.795 - - -
MFE -48.798 -28.313 -58.459 -43.902
Ligands - cobalamin TPP FMN
Gene RFC3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.004 4. 11.
Length SE - 1. 4. 0.
Lev Distance - 47. 43. 49.
UBS 11. 11. 12. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 3.
ILR 2. 2. 2. 3.
H 5. 5. 4. 3.
BL 3. 3. 4. 1.
BR 3. 3. 3. 3.
UN 0.135 0.201 0.124 0.155

Sequences

Field Description
UTR seq + 25 uuuacgcggccgcgaccgguagugacgucacgagauuuggagcucgcgggaaaacuugucucugcguuguggggaggacgcgcgcucgcgcgggauuuucaagcguaggcccccgggaacucgagcugccATGAGCCTCTGGGTGGACAAGTATC
UTR dot + 25 ….(((.((((….)))).)))……((((……..))))((((….))))..((((((((.((((((…(((((….)))))…))))))))))))))((((((((..((((.(….).))))..)))))).))………
RS 1 seq AACCAUACUCUUAAUCAAGAUGUAGGGAAAUUGGUGAAAAUCCAAUACAGCCCCCGCUACUGUAAACAUAUCGGCCAUAAAUACCACUGAGAAAUUGGGAAGGUUUGGCUUUAAAGGUGUGAGUCAGGAAACCUGUCUUGAAAUAACUUCGGAG
RS 1 dot ..((.(((((((….)))).)))))…(((((…….)))))..(((….)))……..(((((((((((…..(((.((((….))))…))).)))))…..))))))((.((((…)))).))…………….
RS 2 seq CCGGUGUCCAAGGGGAGCCAAACGGCUGAGAGGUCCGCACAAAGCGGACGACCCUGGGGCCUGCGUUUCGCGACACUGCUCGCCAUCGACGAGUUGCAGGCCCUCGUACCUGAUCCGGUUAGUACCGGCGUAGGAAUGGCCAUGAAACAUUUG
RS 2 dot ..(((.(((….))))))…(((..(.(..((((((…..))))))..)))))(((((((((.(((((((…………))).)))).)))))))))((((.((((..(((((….)))))..)))).))))…………..
RS 3 seq AUCCAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGCGGUAAUUGAAGAUUCCCUCUUCAUCAGCCCGUGAGCGGAAAAAUUCAGCAAUGAAUUUUUCAUGCUGAUCUGGUGUAACUCCAGAGCCGACAGUAUAGUCUGGAUGGGAGAAGAUGUUG
RS 3 dot ….((((((((((..(((…….)))..))……..))))))))……..((((((…((.((((((((((((((….)))))))))).)))).))))))))…((((….(((((……))).))…))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table