Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090420 Similarity: 0.965 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA090420
Gene: RFX2
MFE: -20.093
ENS: 0.821
Length: 130.
Predicted Ligands:
cobalamin - 6/20
SAM - 5/20
TPP - 3/20
 RS: URS0000D9EE80_1121322
MFE: -37.865
Ligand: TPP
Species: Anaerocolumna jejuensis DSM 15929 TPP riboswitch (THI element)
 RS: URS0000AB87CC_12908
MFE: -29.258
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000ABA936_1262757
MFE: -32.002
Ligand: FMN
Species: Blautia sp. CAG:37 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090420 URS0000D9EE80_1121322 URS0000AB87CC_12908 URS0000ABA936_1262757
Length 130. 132. 131. 129.
Similarity - 0.965 0.963 0.963
Ensemble Norm 0.821 - - -
MFE -20.093 -37.865 -29.258 -32.002
Ligands - TPP cobalamin FMN
Gene RFX2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.047 4.018 2.034
Length SE - 4. 1. 1.
Lev Distance - 40. 47. 48.
UBS 7. 6. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 2. 2. 1.
H 4. 4. 3. 5.
BL 2. 0. 2. 1.
BR 1. 0. 2. 1.
UN 0.346 0.129 0.214 0.163

Sequences

Field Description
UTR seq + 25 agacgggaacagcaugguggauggugugcaaaugacugauuuaaacauuuaaaggaaacuguaaauacaagcagcuuguaacagaaaaauuccaaagaccugagcATGCAGAATTCCGAGGGTGGAGCGG
UTR dot + 25 ……..(((.(((…..))).)))……………………..((((.((((…((((((…))))))))))…..))))……(((……)))..(((((….)))))…
RS 1 seq GCCAUGAACUAGGGGUGCCUGAUGAAUCAGGCUGAGAGAAAACUACCAGAAUGUUUUAAACCCUGAGGCAGUGAGAGCUGCUUCAUACCUGAUCCGGAUAAUGCCGGCGUAGGGAUGUAUAGAAUUUUGCGG
RS 1 dot …………((((((((((….))))))………………………))))(((((((((….)))))))))..((((..((((……))))..))))..((((……..)))).
RS 2 seq UAGCUGAAAUGCAUGGUGGGAAAUUCGUGUGAAAGUCAUGAGCUGUACCCGCAACCGUAUAGUCGGAGCGCCACCCAGUUAAGUCCGCUGUUGAAUGAUGGCCGGGAACAGUCUAGUUCUACAAUGAAAAA
RS 2 dot ……….((((((……..))))))………..(((((.((((…((((((((.((((((……..))….))))))))……)))).)))).)))))….(((……)))…
RS 3 seq GGAGAUCUUCAGGGCAGGGUGUGAUUCCCUACUGGCGGUAUAGUCCGCGACCCGCUGCGAUAUCAAACAGCGGCUGACUCGGUGCAACUCCGGGACCAACAGUUAAAGUCUGGAUGAAAGAAGAUGAAA
RS 3 dot ………(((…((((…….)))).)))((((……))))…((((((……….))))))(((.(((((…….)))))…..)))…..((((……….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table