Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090596 Similarity: 0.960 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA090596
Gene: RGP1
MFE: -66.180
ENS: 0.
Length: 170.
Predicted Ligands:
lysine - 11/20
cobalamin - 4/20
glucosamine - 3/20
 RS: URS0000D8A079_1121919
MFE: -44.951
Ligand: glucosamine
Species: Geosporobacter subterraneus DSM 17957 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS000231EAE8_1802292
MFE: -58.326
Ligand: cobalamin
Species: Syntrophus sp. RIFOXYC2_FULL_54_9 Cobalamin riboswitch
 RS: URS0000ABBF70_373903
MFE: -64.326
Ligand: glucosamine
Species: Halothermothrix orenii H 168 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090596 URS0000D8A079_1121919 URS000231EAE8_1802292 URS0000ABBF70_373903
Length 170. 170. 170. 171.
Similarity - 0.960 0.959 0.957
Ensemble Norm 0. - - -
MFE -66.180 -44.951 -58.326 -64.326
Ligands - glucosamine cobalamin glucosamine
Gene RGP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 6. 7.
Length SE - 0. 0. 1.
Lev Distance - 48. 52. 53.
UBS 13. 11. 14. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 3. 4. 3. 3.
H 3. 3. 5. 3.
BL 4. 4. 4. 5.
BR 5. 3. 5. 4.
UN 0.118 0.159 0.112 0.129

Sequences

Field Description
UTR seq + 25 gggaagucccgccucuaccgcccagcggacgccgccgccgccgccgccgccgcguaccuagccaggucccugaggggcgggcagaugaggccuaggggugccgaucccuagugucgacuaugcgagaucugauuccggagcugccATGATTGAAGTGGTAGCAGAGCTCA
UTR dot + 25 …..(.(((((((((…(((..((((((((.((.((…….)).)).)))).))..))..)))…..))))))))))……(((((((((((….)))))))).)))……..(((.(((………((((((((…….))))))))))).))).
RS 1 seq UACCAAAUAAAAGCGCCAGGACUUGAAUCAGAUCGGACAAUUCAGGAUUCAAGUUGACGAGGUCCAGGGUUUAUCGAAGAUUCGGCGGAUGCCCUGCGGAAUUCACCAACGUUAAACGUCCUACAAAGACUCCAAGUGAUUGGAGGGACAAAUGGGACUGGGUGACAAAA
RS 1 dot ……….((((.((.(((((((((((.((………))..))))))………))))).))))))……(((((.((((…..)))).)))))…….((((..(((((((……((((((….))))))…….)))))).)..))))….
RS 2 seq UCAUAGAAGAUCGAGGUGGAUGUGUGGAAGGGGGGUGAGAUUCCCCCGCUGCCCCGCAGCCGUGAAGGGAACGAAAGCCCGAAAAGCCACUCUCGCGAGGGAAUCGUGAGGGGAAGGCGGGCGAGUAGGCGGCCCGAAGCCGGAAGACCAAUCCACCGACAGCAUUCCCG
RS 2 dot ……….(((.(((…((((.((.(((((((…….))))).)).)).))))))).))).(((……..)))…..(((.(((((((((…..)))))))))…)))((((………))))((((((((..((….))..)))…)).)))…
RS 3 seq AUUUAAAGAAAAGCGCCUGGACUUAGAUGAAAAUAUUAUCUUCAUCUAAGUUGACGAGGGAGGGGGUUAUCGAAAUGAUCGGCGGAUGCCCCCAGGCCUUCUGCCGGGCCUGAAGUCAUUCCUCAAACCCGUGGAGUGAUCUACGGAACAAAGGGAAUGACAGGCAGAAAA
RS 3 dot …….((.((.(.(((.((((((((((((………)))))))))))).)…….)).).)).))……..(((((((.(((….)))..))))))).((((…(((((((((…..(((((((….)))))))……)))))))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table