Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090652 Similarity: 0.979 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA090652
Gene: RGS16
MFE: -17.148
ENS: 0.683
Length: 102.
Predicted Ligands:
purine - 15/20
TPP - 3/20
SAM - 2/20
 RS: URS0000BE847A_1759557
MFE: -18.883
Ligand: purine
Species: Sporosarcina sp. HYO08 Purine riboswitch
 RS: URS0000C6FCC3_1236974
MFE: -22.613
Ligand: purine
Species: Paenibacillus sp. JCM 10914 Purine riboswitch
 RS: URS0000D9F267_54914
MFE: -25.707
Ligand: purine
Species: Brevibacillus parabrevis Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090652 URS0000BE847A_1759557 URS0000C6FCC3_1236974 URS0000D9F267_54914
Length 102. 102. 102. 102.
Similarity - 0.979 0.977 0.977
Ensemble Norm 0.683 - - -
MFE -17.148 -18.883 -22.613 -25.707
Ligands - purine purine purine
Gene RGS16 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.008 4.016 6.031
Length SE - 0. 0. 0.
Lev Distance - 24. 29. 29.
UBS 7. 5. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 2.
ILR 2. 1. 1. 3.
H 3. 4. 4. 2.
BL 3. 1. 3. 2.
BR 0. 0. 1. 1.
UN 0.294 0.206 0.167 0.118

Sequences

Field Description
UTR seq + 25 acugcuuacccuaaguccaacuaagaguuugaggugucagcuucagcaaucaccaagcaagccuuucugugaauuuuATGTGCCGCACCCTGGCCGCCTTCC
UTR dot + 25 …(((((…)))))……(((.(((((.((((…((….))…))))…))))))))…………..(.((((…..)))))…….
RS 1 seq ACUAAACAAAUGUUUAUUGCGUGUAUAUGCUUAGGAAUAUGGCUUAAGCGUUUCUACCUGGUAACCUUAAACUACCGGACUACAUGAAGAAUGACUGAAUAC
RS 1 dot ..(((((….)))))……(((.(((((((((…….)))))))))…)))((((((………))))))….(((…..)))………
RS 2 seq AUUUUCAUAAGACAAUCUUAAUGUAUAUGCCGGGGAAUAGGGCCCGGGCGUCUCUACCAGGUUACCGUAAAUGACUUGACUACAUGAAGGAUGAGAAGAAGA
RS 2 dot …….(((((…)))))..(((.(((((.(((…….))).)))))…)))(((((((…….))))))).((.(((…..)))))…….
RS 3 seq AACAGGUAAUAUAGGAAGGUUCGUAUAUUCUUGAGAAUAUGGCUCAAGAGUUUCUACGGGGUCGCCAUUAACGACCUGGCUACGAACAAAAUGUCGACGGGA
RS 3 dot ..(((((……((..(.((((((.(((((((((…….)))))))))…)))))).)..))…….)))))….(((……..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table