Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090663 Similarity: 0.957 Similarity: 0.956 Similarity: 0.955
UTR: 5HSAA090663
Gene: RGS20
MFE: -46.917
ENS: 0.905
Length: 159.
Predicted Ligands:
glucosamine - 7/20
FMN - 5/20
Mg2+ - 4/20
 RS: URS0000D9BFF0_1797535
MFE: -49.355
Ligand: FMN
Species: Candidatus Buchananbacteria bacterium RIFCSPHIGHO2_01_FULL_44_11 FMN riboswitch (RFN element)
 RS: URS0000DA5926_519472
MFE: -31.955
Ligand: Mg2+
Species: Vagococcus teuberi M-box riboswitch (ykoK leader)
 RS: URS0000D88BF0_1529
MFE: -35.156
Ligand: Mg2+
Species: Clostridium cadaveris M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090663 URS0000D9BFF0_1797535 URS0000DA5926_519472 URS0000D88BF0_1529
Length 159. 157. 161. 162.
Similarity - 0.957 0.956 0.955
Ensemble Norm 0.905 - - -
MFE -46.917 -49.355 -31.955 -35.156
Ligands - FMN Mg2+ Mg2+
Gene RGS20 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.004 1. 8.
Length SE - 4. 4. 9.
Lev Distance - 46. 53. 44.
UBS 10. 9. 10. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 4. 1. 4. 2.
H 4. 5. 4. 4.
BL 2. 3. 3. 2.
BR 2. 3. 2. 2.
UN 0.195 0.255 0.211 0.210

Sequences

Field Description
UTR seq + 25 gaggaagaggccgggagaagagggcuagagcaaagaccgagagccggagaaaggcgaaaggcgcggugagcaaucgccgacguagagagggcagcccuccgcgcugcaauauugagaaggcacccgcgggacgcATGCCCCAGCTTTCCCAAGATAACC
UTR dot + 25 ……..((((……….))))……….((….(((…….)))….))((((((((….)))))).)).((((.(((((((..((((((.(((…………)))..))))))..)).)))))…))))…………
RS 1 seq AAUAUCCUUCGGGGUCGGGUGAAAGUCCCAAUCGGUGGUAAAGCCCACGAGCCCAUAGCCGGGCAUGAUCUGGUGUAAUUCCAGAGCCGACCGUAUGCCGAUGUAAAAUCGGCAUCCUGAUUCUAUAUCGGGAAAGUCGGGAUGAAAGAAGGUAAUU
RS 1 dot ………..(((.(……..).)))…..((((……))))..((((……))))….(((((…….))))).(((((….(.((((((((.((((((….)))))).)))))))).)..)))))……………..
RS 2 seq AAUGAAUUUUGUUAGGUGAGGCUCCUAUGCAAACACAGGCUAUUGCCCAAAAACGUCGAGAGACACCAAUGGGUAGAACAGGAAUUGUCGUGAAGGCUUUUCAUAAGAUAGCUAAGAUUUUUCUUUACGUUGUAUAGUGCUAAAGCUCAACAUAUUACUUA
RS 2 dot …….(((((((((…….)))).)))))………(((((((…..(((….)))…..)))))))..((.((….)).))..((((((.(((…(((((.((((….))))…)))))…)))..))))))…………..
RS 3 seq AUAAAACCUCGGUAGGUGAGGUUACUACAAGGAUACGGGUUGAUGCCGUGAAAGAAUGGAAACAUUUUUAACAGGUUAGCAGGUUUGGCCGAACAAAGAAGGCUUAAUCUAAUUCAACUUCAUUGCCUUGCAGAGCCAAAACUUGAACGAAACGUAUUUUUA
RS 3 dot ….(((((((…..)))))))……….(((((…….))))).(((((((….)))))))..((((((….(((((.((….(((.((((…………….)))).)))….)).)))))..))))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table