Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090749 Similarity: 0.963 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA090749
Gene: RHBDD1
MFE: -39.382
ENS: 0.888
Length: 146.
Predicted Ligands:
FMN - 8/20
cobalamin - 4/20
TPP - 3/20
 RS: URS0000D94C3F_1121353
MFE: -43.159
Ligand: cobalamin
Species: Corynebacterium callunae DSM 20147 AdoCbl riboswitch
 RS: URS0000AB7AA4_695850
MFE: -66.375
Ligand: TPP
Species: Saprolegnia parasitica CBS 223.65 TPP riboswitch (THI element)
 RS: URS0000D95B11_1954209
MFE: -59.620
Ligand: FMN
Species: bacterium AM6 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090749 URS0000D94C3F_1121353 URS0000AB7AA4_695850 URS0000D95B11_1954209
Length 146. 145. 147. 147.
Similarity - 0.963 0.963 0.962
Ensemble Norm 0.888 - - -
MFE -39.382 -43.159 -66.375 -59.620
Ligands - cobalamin TPP FMN
Gene RHBDD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 5.006 8.
Length SE - 1. 1. 1.
Lev Distance - 42. 47. 47.
UBS 10. 9. 9. 10.
BS 0. 0. 0. 1.
ILL 3. 2. 2. 2.
ILR 4. 2. 5. 5.
H 2. 2. 2. 2.
BL 1. 3. 2. 3.
BR 3. 5. 2. 2.
UN 0.123 0.152 0.048 0.109

Sequences

Field Description
UTR seq + 25 gacguggggacgcaggcgggucguagagagcguucagccgucuguauaucuccccagauaccugaaacugaccaccugaguacguuuucccauugcugagcuguuucccugauaucuggccATGCAACGGAGATCAAGAGGGATAA
UTR dot + 25 …(((((((((((((..((((((……..(((((..(((((……….)))))..))))))).)))).))))….))))..)))))…………((((((((.((((………)))).))))…))))…
RS 1 seq UUCAGCAAGUUUUUAUUUUCAGGGGAAGUCCGGUGAGAAUCCGGCGCUGACCCGCAACCGUAUGGGUGCUGUGUGGCACUGAAGUCGGAUUACCUGGAAAUAUUCUUUGGCUUCAACCGUCGUGGAUUACGGUUCUGCAGCCCGU
RS 1 dot ………….((((((((((…(((((((……..(.((((.((((((……..))))).).)))).)……..))))))).))))))))))……((((.(((((((……..)))))..)).))))…
RS 2 seq UGAACCAGCGAGGGGUGCUUCUCGCGGGUGGGCCCAUGGAAGAGGACGCCUCUUCUGUGAACAUGCCCAGCCCGCGGGUCGCUGAGAUCAUACCCUUUUAACCUGAUCCGGGUAAAACCGGCGGAGGGACUGCUGUGAUGUACCUGG
RS 2 dot …..(((.(((((((((..(((((((((((((.(((((((((((…)))))))))))…..))))).))))))))..))………)))))))….)))..(((((((…(((((((…..)))))).)…)))))))
RS 3 seq AAACGUCUUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAGGUGCGCAAGCACGAGCCCGCGAGCGCCCCGGCCUUGCCGUCGGGGGUCAGCAGAUCCGGUCCAAUGCCGGAGCCGACGGUCAUAGUCCGGAUGAAAGAAGACGGUG
RS 3 dot …(((((((.((((.((((((…..(((.((((((((((((((((..((……..))..))))….)))).)))))))))))…)))..))).))))….((((((((…)))…..)))))……)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table