Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA090757 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA090757
Gene: RHBDD2
MFE: -41.048
ENS: 0.867
Length: 109.
Predicted Ligands:
SAM - 7/20
glycine - 5/20
TPP - 5/20
 RS: URS0000C890BD_1736464
MFE: -49.991
Ligand: glycine
Species: Pelomonas sp. Root1444 Glycine riboswitch
 RS: URS0000D9116E_262324
MFE: -43.758
Ligand: glycine
Species: Lysobacter gummosus Glycine riboswitch
 RS: URS0000C5DF96_54911
MFE: -33.984
Ligand: SAM
Species: Brevibacillus choshinensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA090757 URS0000C890BD_1736464 URS0000D9116E_262324 URS0000C5DF96_54911
Length 109. 110. 109. 109.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.867 - - -
MFE -41.048 -49.991 -43.758 -33.984
Ligands - glycine glycine SAM
Gene RHBDD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 2. 4.
Length SE - 1. 0. 0.
Lev Distance - 31. 34. 35.
UBS 11. 10. 12. 10.
BS 0. 0. 0. 0.
ILL 4. 3. 4. 4.
ILR 5. 4. 4. 5.
H 2. 2. 2. 1.
BL 3. 4. 3. 4.
BR 4. 4. 4. 3.
UN 0.037 0.045 0.037 0.018

Sequences

Field Description
UTR seq + 25 gccaagggaaacugccgcgaggaggcggaaggagcagaggaccggcagccggcgucgaggcggggcgcgggaacgacggcggccATGCTGGGAGTCACCACCGTCCGTT
UTR dot + 25 .((..(((……)).)..))..(((((.((.(..((…((((((((((.(((((..(((…)))…..))))).))))..))))))…))..).)).))))).
RS 1 seq GCGUUCCUCACUGGAGAGAGGCCGGUCCUUGAGCCGGCCCACCGAAGGGGCAAGCCCGAGGCGAUUCGCCUGGGGUCAAUCUCUCAGGUACCCCGGACGGCGAGGACAUC
RS 1 dot ((.((.(((….))).)).))..(((((((.(((((…(((..(((((…((((.(((((…))))).))))…)))))..)))…)))).)..)))))))…
RS 2 seq CAUCGCCGAUCUGGAGAGAGGCCGCCACGCGGCCCACCGAAGGGGCAAGCGGCUGCCGGCGCAUCCCGCCGGGCCGCGCAAACUCUCAGGUAAAAGGACAGCGGGAGCG
RS 2 dot ….(((..((….))..)))((((.(((.(.(((((..((((((..(((((..((((((…..)))))))))))))…))))..)))….)).).))).).)))
RS 3 seq UUCUUAUCCAGAGAGGUGGAGGGUCUGGCCCUAUGAAGCCCGGCAACCGUCAUGAGUCAUGUGACAAGGUGCCAAUUCCUGCGAGACAGUGCGUCUCGAUAGAUAAGAA
RS 3 dot .(((((((.(..((((((.(..((((.((…..(((….(((.((((((((…….)))))..))))))..)))..)).))))..).))))))..).))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table