Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091018 Similarity: 0.989 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA091018
Gene: RICTOR
MFE: -17.899
ENS: 1.
Length: 47.
Predicted Ligands:
preQ_1 - 6/20
SAM - 6/20
glutamine - 5/20
RS: URS0000D67410_12908
MFE: -24.
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
RS: URS0000C1D245_1423727
MFE: -7.804
Ligand: preQ_1
Species: Lactobacillus brantae DSM 23927 PreQ1 riboswitch
RS: URS0000AB8C73_887898
MFE: -9.546
Ligand: preQ_1
Species: Lautropia mirabilis ATCC 51599 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091018 URS0000D67410_12908 URS0000C1D245_1423727 URS0000AB8C73_887898
Length 47. 47. 46. 45.
Similarity - 0.989 0.989 0.989
Ensemble Norm 1. - - -
MFE -17.899 -24. -7.804 -9.546
Ligands - unknown preQ_1 preQ_1
Gene RICTOR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 0. 1.005
Length SE - 0. 1. 4.
Lev Distance - 14. 14. 11.
UBS 3. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 1. 2. 1. 1.
BR 1. 1. 1. 0.
UN 0.085 0. 0.087 0.156

Sequences

Field Description
UTR seq + 25 guugugacugaaacccgucaauATGGCGGCGATCGGCCGCGGCCGCT
UTR dot + 25 ((((((.((((…((((((…))))))…)))).))))))….
RS 1 seq GGGUGCGGCGCCGGGCCGCAGGAGAGCGGAUGGUCGGGCCGCCAUCC
RS 1 dot (((((((((.((((.((((……))))….)))))))).)))))
RS 2 seq ACCCUUGUGGUUCGAAAUUCCGCCCACAAUAAAAAACUAGGAGGCA
RS 2 dot ..((((.(((((….(((……..)))….))))).))))..
RS 3 seq GCCCCCGUGGUUCGAAAAACGCCCACGUUAAAAAACUAGGGAAGA
RS 3 dot …(((.(((((…..((((….))))….))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table