Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091019 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA091019
Gene: RICTOR_0
MFE: -19.704
ENS: 1.
Length: 56.
Predicted Ligands:
unknown - 19/20
glutamine - 1/20

 RS: URS0002309A19_219649
MFE: -26.629
Ligand: unknown
Species: Paraburkholderia unamae nhaA-I
 RS: URS0000E5FA4A_869719
MFE: -24.242
Ligand: unknown
Species: Sphingomonas sp. YIM 65583 sul1 RNA
 RS: URS0000E6063D_1736301
MFE: -26.192
Ligand: unknown
Species: Sphingomonas sp. Leaf231 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091019 URS0002309A19_219649 URS0000E5FA4A_869719 URS0000E6063D_1736301
Length 56. 56. 56. 56.
Similarity - 0.991 0.990 0.990
Ensemble Norm 1. - - -
MFE -19.704 -26.629 -24.242 -26.192
Ligands - unknown unknown unknown
Gene RICTOR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 1. 1.
Length SE - 0. 0. 0.
Lev Distance - 11. 13. 13.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 1. 2. 0. 0.
H 1. 1. 1. 1.
BL 1. 0. 1. 1.
BR 1. 1. 1. 1.
UN 0.125 0.089 0.143 0.143

Sequences

Field Description
UTR seq + 25 guuuccgguguugugacugaaacccgucaauATGGCGGCGATCGGCCGCGGCCGCT
UTR dot + 25 …..((((..((((.((((…((((((…))))))…)))).))))))))..
RS 1 seq GGGUGCCAGCGGCAUACCGUGGCAGGGUAGGACCUUGCGCUGGUCGGGCCGCCGCG
RS 1 dot ….((..(((((..((((..(((((((…)))))))..))))…))))).)).
RS 2 seq CAUGGACCCGGUGCAAUUCCGGGUGGCUAUCCCGGCCGCCGAUCCGCCGGGCAACC
RS 2 dot ….(.(((((((..(((…(((((((…..)))))))))).))))))))….
RS 3 seq CAUGGACCCGGUGCAAAUCCGGGUGGCUAUCCCGGCCGCCGAUCCGCCGGGCAACC
RS 3 dot ….(.(((((((…(((..(((((((…..)))))))))).))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table