Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091043 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA091043
Gene: RIMKLB
MFE: -28.084
ENS: 0.922
Length: 112.
Predicted Ligands:
TPP - 16/20
glycine - 1/20
methionine - 1/20
 RS: URS0000D8882A_1895849
MFE: -47.391
Ligand: TPP
Species: Sphingomonas sp. 67-36 TPP riboswitch (THI element)
 RS: URS0000C540ED_36861
MFE: -31.523
Ligand: glycine
Species: Thiobacillus denitrificans Glycine riboswitch
 RS: URS0000C1DC81_1224164
MFE: -32.350
Ligand: TPP
Species: Corynebacterium vitaeruminis DSM 20294 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091043 URS0000D8882A_1895849 URS0000C540ED_36861 URS0000C1DC81_1224164
Length 112. 111. 112. 112.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.922 - - -
MFE -28.084 -47.391 -31.523 -32.350
Ligands - TPP glycine TPP
Gene RIMKLB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.003 6.005 4.005
Length SE - 1. 0. 0.
Lev Distance - 28. 32. 35.
UBS 11. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 2.
ILR 2. 3. 3. 2.
H 5. 4. 4. 4.
BL 2. 2. 1. 3.
BR 3. 1. 2. 3.
UN 0.071 0.126 0.143 0.143

Sequences

Field Description
UTR seq + 25 gggaugccggcaggacccugcgcccgaggggguagacguuacauccaagaggaaauaauccaggcaaggaagcacaagcugaucaagATGTGTAGTTCTGTGGCTGCCAAGT
UTR dot + 25 ((….)).((((….))))((((….)))).((..(((..(((….)))..)))))(((.((.(((((((((..((…..)).)))))..)))).)).)))……
RS 1 seq CACCUAUCCCCGGGGGACCGCUGUCGCGGCGGUUGAGAGGAGGGCCGCAGCCCUCGACCCGCCGAACCUGAUCCGGCUGACACCGGCGUAGGGAGGGAGCGGCGCAAACCU
RS 1 dot ……((((…))))((((….)))).(((((((.((..(….)..)))))))))(((((..(((..(((.((((….))))…))).)))..)))))…….
RS 2 seq CAAGAACACUCUGGAGAGCGCGGUUUUCAAGCCGCCACCGAAGGGGCAGCGGCCCAGGCUUCAUCACCCAGCGCGCCGUAAUCUCUCAGGUACCAAGGACAGAGGGGUGAAG
RS 2 dot ……..(((….))).((((((….))))))….((((((((….))))…)))).((((((..(..(((((.((((…))))))…)).).)..))))))..
RS 3 seq GUCAAUCCCCACGGGCACCCAAGGCAUGGGCUGAGAUCGCGCUGACGCCGCGCGAGCACCGUAUGAACCUGUCUGGCUAGCACCAGCGAAGGAAGAGAGGAUGCGUUAAUGU
RS 3 dot ……(((…)))((((((…..)))).)).(.((((((…….)))))).)..(((((…(((.(((..((.((….))..))..))).))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table