Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091137 Similarity: 0.988 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA091137
Gene: RIPK4
MFE: -26.592
ENS: 0.946
Length: 73.
Predicted Ligands:
fluoride - 6/20
cobalamin - 4/20
homocysteine - 3/20
 RS: URS0000DA3FD3_1804758
MFE: -30.931
Ligand: cobalamin
Species: Streptomyces sp. CB03911 Cobalamin riboswitch
 RS: URS0000BFD203_945713
MFE: -12.199
Ligand: SAM
Species: Ignavibacterium album JCM 16511 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C74794_1706438
MFE: -16.535
Ligand: fluoride
Species: Arc I group archaeon BMIXfssc0709_Meth_Bin006 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091137 URS0000DA3FD3_1804758 URS0000BFD203_945713 URS0000C74794_1706438
Length 73. 72. 74. 72.
Similarity - 0.988 0.987 0.986
Ensemble Norm 0.946 - - -
MFE -26.592 -30.931 -12.199 -16.535
Ligands - cobalamin SAM fluoride
Gene RIPK4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 2. 4.001
Length SE - 1. 1. 1.
Lev Distance - 14. 16. 16.
UBS 4. 5. 4. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 2. 1. 2. 3.
H 1. 1. 1. 1.
BL 2. 3. 2. 3.
BR 0. 1. 1. 0.
UN 0.123 0.125 0.135 0.097

Sequences

Field Description
UTR seq + 25 aaauucggugggucgguugucgucugugcauaauuugagagggagcgcATGGAGGGCGACGGCGGGACCCCAT
UTR dot + 25 …….(.(((((.((((((((((((((……………)))))…..)))))))))..))))))..
RS 1 seq GGAAAGCCGGUGCGACACCGGCGCUGACCCCGCAACCGUGAGCCCGCGCCCAGGCGCCGGGCGAGCCGGACC
RS 1 dot ……(((((.((.(.((((((((…..(((…………)))….))))))))))).)))))…
RS 2 seq UAAAUGCACAGUGGGAUUUGAGCCGUAUUGCAGCCACUAUAAAAAACUGCUAAAAAGGCAAACAGAACUUAUUU
RS 2 dot ………((((((.((((.(((…..((((………….))))……)))…)))).)))))).
RS 3 seq AUUCUCUUUGGUGAUGAAGUCCGCCAAGGCCCUAGCCUAAACUGCCUUCAAGCUGAUGACUUCUUUUAUCAA
RS 3 dot …….(((((((.((((((.((.(((((…((……)))))))…))….))))))..)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table