Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091188 Similarity: 0.969 Similarity: 0.967 Similarity: 0.965
UTR: 5HSAA091188
Gene: RMND5A
MFE: -31.586
ENS: 0.834
Length: 129.
Predicted Ligands:
cobalamin - 13/20
glycine - 2/20
SAM - 2/20
 RS: URS0000AB3F78_12908
MFE: -23.044
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000AB5250_12908
MFE: -27.829
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000D9D0F2_1797495
MFE: -55.607
Ligand: glycine
Species: Betaproteobacteria bacterium RIFCSPLOWO2_12_FULL_62_13 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091188 URS0000AB3F78_12908 URS0000AB5250_12908 URS0000D9D0F2_1797495
Length 129. 130. 128. 129.
Similarity - 0.969 0.967 0.965
Ensemble Norm 0.834 - - -
MFE -31.586 -23.044 -27.829 -55.607
Ligands - cobalamin cobalamin glycine
Gene RMND5A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.012 10.009 11.002
Length SE - 1. 1. 0.
Lev Distance - 38. 38. 42.
UBS 10. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 2. 1. 0. 2.
H 2. 2. 2. 2.
BL 5. 5. 3. 2.
BR 4. 6. 5. 3.
UN 0.008 0.115 0.102 0.047

Sequences

Field Description
UTR seq + 25 agguggcaacugucaaccccacgaaacuguguaggaaacauuaacucugcagucagagauaaugugaugacauaauuguuacuucucuagacauucagguuuugATGGATCAGTGCGTGACGGTGGAGC
UTR dot + 25 (((((((((.(((((.(………………..((((((.(((((….))))).))))))).)))))…)))))))))((((..((..(((.((.((((….)))).)).)))..)))))).
RS 1 seq GCAUUGAAUCGUGAUGGGAAAUUAAUGUGAAAAUCAUUAGCUGUGCCUGCAACGGUUAAAGUCCGAGUGCCAUCCAAUGUAGUCCGCUGUUGAAUGAGGGCCAGGGAAAGUCUAAUUCUACAAUUUUAAU
RS 1 dot ((((((.((.((..(.(((……………(.((((((((…….)))))))).)))).)..)).)).))))))…….(((.((((..((((……..)))).)))).)))……..
RS 2 seq UAGCUGAAAGUUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUUCCUGCAACCGUAAAGUCGGAGCGCCACCCAGCUAAGUCCGCUGUGAAUGAAGGCCAGGAAAAGUCUAGUUCUACAAUGAAAAA
RS 2 dot ((((.((…((((((((……………….((((.(((((.((………)).))))))))))))).)))).)).)))).((((..((((……..)))).))))…………
RS 3 seq CGUGGCGACUCUGGAGAGCGUCGAGCCCGGCUGCGGGUUCGUCCACCGAAGGGGCACGCAGCGGCUUGAUCGCCGCCGCAAUCUCUCAGGUUAGGGUCGAAGAGGACUCUUAAGGACAGAGGGGUGAAG
RS 3 dot .((((((……….((((((((((..((((((.((((.((….))..)))).))))))))))))).))))))))).(((((((..(((((((((……))))))….))).)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table