Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091409 Similarity: 0.986 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA091409
Gene: RNF14
MFE: -23.886
ENS: 0.848
Length: 72.
Predicted Ligands:
homocysteine - 10/20
cobalamin - 2/20
glutamine - 1/20
 RS: URS0002321D03_1262758
MFE: -14.711
Ligand: cobalamin
Species: Blautia sp. CAG:52 AdoCbl variant RNA
 RS: URS0000C5C846_12908
MFE: -20.388
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000D7CCB0_1802374
MFE: -23.069
Ligand: homocysteine
Species: Thiobacillus sp. GWE1_62_9 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091409 URS0002321D03_1262758 URS0000C5C846_12908 URS0000D7CCB0_1802374
Length 72. 72. 74. 71.
Similarity - 0.986 0.985 0.984
Ensemble Norm 0.848 - - -
MFE -23.886 -14.711 -20.388 -23.069
Ligands - cobalamin glutamine homocysteine
Gene RNF14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 1. 10.007
Length SE - 0. 4. 1.
Lev Distance - 18. 16. 17.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 2. 1. 2. 0.
H 2. 2. 2. 2.
BL 2. 3. 3. 3.
BR 2. 2. 2. 0.
UN 0.097 0.153 0.081 0.183

Sequences

Field Description
UTR seq + 25 gggcggaacuuugggguucggcacugccgggcggccggaagguccuuATGCAATTTCTTAAGGAAGAGACCC
UTR dot + 25 ..(((((.((((.(((((((((…)))))))..)).)))).)))….))..((((((….))))))…
RS 1 seq AUACAGUUGCAGGAAAACAGGUGAAAUUCCUGUACAAGUCCGUUACCGUUAAAGUCGGAGUACUCUCUGUAU
RS 1 dot ..((.((.((.(((..(((((…….)))))…..))))).)).))……(((((….)))))…
RS 2 seq GUCGUUCAUCUCUUUUAGAGAUCUCUUUAAAGGAGACGGAAGUAAGAGACAUAGUGUCCCUGAAGGAACGCGUG
RS 2 dot (((.(((.((((((((((((….))))))))))))..))…..).)))…((((.((….)).))))…
RS 3 seq GGUUCUGAGGAGCGCUGCGACGGGUCACCCGCCAGGCUCAGAACGCUUCCUUUCAACGGCGCUCACGUUUU
RS 3 dot .(((((…((((.(((.(.((((…)))))))))))))))))……….((((…….))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table