Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091417 Similarity: 0.954 Similarity: 0.945 Similarity: 0.935
UTR: 5HSAA091417
Gene: RNF141
MFE: -69.332
ENS: 0.787
Length: 191.
Predicted Ligands:
cobalamin - 12/20
lysine - 5/20
glycine - 1/20
 RS: URS0000D8B92D_1903704
MFE: -64.692
Ligand: lysine
Species: Tumebacillus sp. AR23208 Lysine riboswitch
 RS: URS000231E820_709991
MFE: -38.870
Ligand: cobalamin
Species: Odoribacter splanchnicus DSM 20712 Cobalamin riboswitch
 RS: URS000232E88E_96773
MFE: -89.169
Ligand: cobalamin
Species: Thauera chlorobenzoica Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091417 URS0000D8B92D_1903704 URS000231E820_709991 URS000232E88E_96773
Length 191. 190. 190. 189.
Similarity - 0.954 0.945 0.935
Ensemble Norm 0.787 - - -
MFE -69.332 -64.692 -38.870 -89.169
Ligands - lysine cobalamin cobalamin
Gene RNF141 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 39.029 10.004
Length SE - 1. 1. 4.
Lev Distance - 60. 58. 78.
UBS 7. 8. 3. 6.
BS 8. 8. 12. 9.
ILL 2. 2. 0. 0.
ILR 1. 1. 0. 1.
H 3. 3. 2. 3.
BL 4. 5. 5. 4.
BR 6. 6. 6. 4.
UN 0.120 0.105 0.289 0.180

Sequences

Field Description
UTR seq + 25 gcuuugcgucacagaggugcgaccgggucccggccugagucgcggccacccgcaggucugagcugugggcugaggcagcgcagccgcugccgcagggugcgcgaugccuugaaccugggaaacuaugugaagcaacacucuggauuuugaaagacaucuuuucaucATGGGACAGCAAATTTCGGATCAGA
UTR dot + 25 …((((.(((((..(((….(((((((..(((….(((((((((.(((((((…….)))))))(((.(((((((….))))))).)))))).)))))))))..)).)))))…))).))))).))))…(((((..(((((((…..((.(((……))).))….))))))))))))
RS 1 seq GAGUGGGGUAGAGGCGCGGGUAAGAUGAGUACCGGUUCGGAAGUGGUGGCCCACUGAUGAUGAAUGAGGGAAAGGCUGACCGCCGAAGCGGAGAGCCUGCCAUGGGUUCGCUGCUGGGCCGGCAUUAAACAAAUGUCGGACUGUCACCACAGAGUCUGUUUUGUUCUGCUGGUGAUGCGCUACUUCAUGA
RS 1 dot ..(((((((…(((((.(((..(((((((.(((((((((.(((((..(((((((.((…..)).))((..(((((..((((….))))..))))).)).)))))))))).))))))))).)))…….))))..)))((((((((((((.(……)))))).)))))))))))))))))))..
RS 2 seq UAUCUUUGUAGCAGCAUCGGUAUCCCCGCAUGGGAAUUUGGGAAUUCGGUGAAAACCCGAAGCUGUCCCCGCAGCUGUAAAGUCAUUACUGUCAUUUUGCAGGUCUUUUCAAUGAUCCACUGAAACCCGGGCGUUUUGGGAAGGAGAAAAAAUGACAAGCCAGAAAACCUGCCGAUCAUAGCUAAUAAAC
RS 2 dot ….((((((((…((((((((((((((.((((..((.((((..(((.((((((.((…(((((….)))))((((((((.((….)).))))))))))..)))))).)))))).).))..)))).)))….))))……………………….)))))))….))).))))).
RS 3 seq ACAAUCGGACCUCCUUUCGGUUCGACGAAACGGAACACGGUGCAAAUCCGUGGCGGGCCCGCCGCUGUAUCCGGGGACGGGCGCUGCAAGGUCGACAGACCGGCCACUGGCGGGGACCACCCCGCCGGGAAGGCGCAGCGCUACGGCUGAUCCGGGAGCCAGAAGACGUGUCGAACCGCGGAGGAGUCC
RS 3 dot ……(((.(((((((((((((((((….((..(.(((..((…(((((((..(((((((.(((….))))).)))))(((((..((((….)))).(((.(((((((((….)))))))))…))))))))))))))).))..))).)..))……..)))))))))).))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table