Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091531 Similarity: 0.983 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA091531
Gene: RNF170
MFE: -16.853
ENS: 0.941
Length: 66.
Predicted Ligands:
cobalamin - 13/20
fluoride - 5/20
unknown - 1/20
 RS: URS0000DB6292_310780
MFE: -27.537
Ligand: cobalamin
Species: Streptomyces rubidus Cobalamin riboswitch
 RS: URS0000AB534D_314283
MFE: -20.441
Ligand: cobalamin
Species: Reinekea blandensis MED297 Cobalamin riboswitch
 RS: URS0000D8EEC1_1428626
MFE: -24.110
Ligand: fluoride
Species: Streptomyces malaysiense Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091531 URS0000DB6292_310780 URS0000AB534D_314283 URS0000D8EEC1_1428626
Length 66. 65. 66. 65.
Similarity - 0.983 0.983 0.982
Ensemble Norm 0.941 - - -
MFE -16.853 -27.537 -20.441 -24.110
Ligands - cobalamin cobalamin fluoride
Gene RNF170 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 7.004 4.
Length SE - 1. 0. 1.
Lev Distance - 21. 21. 22.
UBS 7. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 0. 1. 0. 1.
H 3. 3. 3. 2.
BL 2. 1. 1. 1.
BR 3. 2. 2. 3.
UN 0.106 0.062 0.167 0.092

Sequences

Field Description
UTR seq + 25 cgcucgccccacgggccgcgcguggagggucccgaccuggaATGGCCAAATATCAAGGTGAAGTTC
UTR dot + 25 (((..((((…)))).)))((.(((…)))))((((.((((……)).)).))))…….
RS 1 seq GCCGGUGCAAUUCCGGCACGGUCGCGCCACUGUGUGCCCCCGGCCCCGGCCGCGGGUGAGUCAGA
RS 1 dot (((((…….)))))..(((…))).((((..((((.((((….)))).))))..).))).
RS 2 seq GGAAUGCGGUGAGAAUCCGCAGCGGACGCGCCACUGUAUGCAGCCCCGAGCUGUAAGCCAGGAGAC
RS 2 dot ….(((((…….)))))(((….)))..((((.((((((…..)))))).)).))…..
RS 3 seq GAACGCGCCGGUGAUGGGGCUCACCGCAACCGCGGCGACAUGCCGCUGACGGUCCCUGGUCGAAC
RS 3 dot ….((.(((….))).))((((((..(((((((((……))))).))))…)))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table